ID: 1084489466

View in Genome Browser
Species Human (GRCh38)
Location 11:69470721-69470743
Sequence GACCCAAATCTCTTTCCCAC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1084489466_1084489477 21 Left 1084489466 11:69470721-69470743 CCCGTGGGAAAGAGATTTGGGTC No data
Right 1084489477 11:69470765-69470787 GTGGAGCTCCCTTCTATAGGTGG No data
1084489466_1084489470 -10 Left 1084489466 11:69470721-69470743 CCCGTGGGAAAGAGATTTGGGTC No data
Right 1084489470 11:69470734-69470756 GATTTGGGTCCAGGAGACCTGGG No data
1084489466_1084489480 30 Left 1084489466 11:69470721-69470743 CCCGTGGGAAAGAGATTTGGGTC No data
Right 1084489480 11:69470774-69470796 CCTTCTATAGGTGGAATAATTGG No data
1084489466_1084489473 2 Left 1084489466 11:69470721-69470743 CCCGTGGGAAAGAGATTTGGGTC No data
Right 1084489473 11:69470746-69470768 GGAGACCTGGGTCCTCGTGGTGG No data
1084489466_1084489476 18 Left 1084489466 11:69470721-69470743 CCCGTGGGAAAGAGATTTGGGTC No data
Right 1084489476 11:69470762-69470784 GTGGTGGAGCTCCCTTCTATAGG No data
1084489466_1084489472 -1 Left 1084489466 11:69470721-69470743 CCCGTGGGAAAGAGATTTGGGTC No data
Right 1084489472 11:69470743-69470765 CCAGGAGACCTGGGTCCTCGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1084489466 Original CRISPR GACCCAAATCTCTTTCCCAC GGG (reversed) Intergenic
No off target data available for this crispr