ID: 1084489470

View in Genome Browser
Species Human (GRCh38)
Location 11:69470734-69470756
Sequence GATTTGGGTCCAGGAGACCT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1084489460_1084489470 16 Left 1084489460 11:69470695-69470717 CCTTGAGGAAGGGTTGGTCTTAT No data
Right 1084489470 11:69470734-69470756 GATTTGGGTCCAGGAGACCTGGG No data
1084489466_1084489470 -10 Left 1084489466 11:69470721-69470743 CCCGTGGGAAAGAGATTTGGGTC No data
Right 1084489470 11:69470734-69470756 GATTTGGGTCCAGGAGACCTGGG No data
1084489459_1084489470 17 Left 1084489459 11:69470694-69470716 CCCTTGAGGAAGGGTTGGTCTTA No data
Right 1084489470 11:69470734-69470756 GATTTGGGTCCAGGAGACCTGGG No data
1084489465_1084489470 -9 Left 1084489465 11:69470720-69470742 CCCCGTGGGAAAGAGATTTGGGT No data
Right 1084489470 11:69470734-69470756 GATTTGGGTCCAGGAGACCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1084489470 Original CRISPR GATTTGGGTCCAGGAGACCT GGG Intergenic
No off target data available for this crispr