ID: 1084489476

View in Genome Browser
Species Human (GRCh38)
Location 11:69470762-69470784
Sequence GTGGTGGAGCTCCCTTCTAT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1084489465_1084489476 19 Left 1084489465 11:69470720-69470742 CCCCGTGGGAAAGAGATTTGGGT No data
Right 1084489476 11:69470762-69470784 GTGGTGGAGCTCCCTTCTATAGG No data
1084489467_1084489476 17 Left 1084489467 11:69470722-69470744 CCGTGGGAAAGAGATTTGGGTCC No data
Right 1084489476 11:69470762-69470784 GTGGTGGAGCTCCCTTCTATAGG No data
1084489471_1084489476 -4 Left 1084489471 11:69470743-69470765 CCAGGAGACCTGGGTCCTCGTGG No data
Right 1084489476 11:69470762-69470784 GTGGTGGAGCTCCCTTCTATAGG No data
1084489466_1084489476 18 Left 1084489466 11:69470721-69470743 CCCGTGGGAAAGAGATTTGGGTC No data
Right 1084489476 11:69470762-69470784 GTGGTGGAGCTCCCTTCTATAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1084489476 Original CRISPR GTGGTGGAGCTCCCTTCTAT AGG Intergenic
No off target data available for this crispr