ID: 1084489477

View in Genome Browser
Species Human (GRCh38)
Location 11:69470765-69470787
Sequence GTGGAGCTCCCTTCTATAGG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1084489471_1084489477 -1 Left 1084489471 11:69470743-69470765 CCAGGAGACCTGGGTCCTCGTGG No data
Right 1084489477 11:69470765-69470787 GTGGAGCTCCCTTCTATAGGTGG No data
1084489467_1084489477 20 Left 1084489467 11:69470722-69470744 CCGTGGGAAAGAGATTTGGGTCC No data
Right 1084489477 11:69470765-69470787 GTGGAGCTCCCTTCTATAGGTGG No data
1084489466_1084489477 21 Left 1084489466 11:69470721-69470743 CCCGTGGGAAAGAGATTTGGGTC No data
Right 1084489477 11:69470765-69470787 GTGGAGCTCCCTTCTATAGGTGG No data
1084489465_1084489477 22 Left 1084489465 11:69470720-69470742 CCCCGTGGGAAAGAGATTTGGGT No data
Right 1084489477 11:69470765-69470787 GTGGAGCTCCCTTCTATAGGTGG No data
1084489474_1084489477 -9 Left 1084489474 11:69470751-69470773 CCTGGGTCCTCGTGGTGGAGCTC No data
Right 1084489477 11:69470765-69470787 GTGGAGCTCCCTTCTATAGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1084489477 Original CRISPR GTGGAGCTCCCTTCTATAGG TGG Intergenic
No off target data available for this crispr