ID: 1084492529

View in Genome Browser
Species Human (GRCh38)
Location 11:69486591-69486613
Sequence AAGACCCCCCAGGACAGCGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1084492529_1084492536 11 Left 1084492529 11:69486591-69486613 CCCTCGCTGTCCTGGGGGGTCTT No data
Right 1084492536 11:69486625-69486647 TGCCTTCTGCTCAGAGACTGAGG No data
1084492529_1084492538 17 Left 1084492529 11:69486591-69486613 CCCTCGCTGTCCTGGGGGGTCTT No data
Right 1084492538 11:69486631-69486653 CTGCTCAGAGACTGAGGATGAGG No data
1084492529_1084492539 24 Left 1084492529 11:69486591-69486613 CCCTCGCTGTCCTGGGGGGTCTT No data
Right 1084492539 11:69486638-69486660 GAGACTGAGGATGAGGAGAGAGG No data
1084492529_1084492540 25 Left 1084492529 11:69486591-69486613 CCCTCGCTGTCCTGGGGGGTCTT No data
Right 1084492540 11:69486639-69486661 AGACTGAGGATGAGGAGAGAGGG No data
1084492529_1084492541 26 Left 1084492529 11:69486591-69486613 CCCTCGCTGTCCTGGGGGGTCTT No data
Right 1084492541 11:69486640-69486662 GACTGAGGATGAGGAGAGAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1084492529 Original CRISPR AAGACCCCCCAGGACAGCGA GGG (reversed) Intergenic