ID: 1084494287

View in Genome Browser
Species Human (GRCh38)
Location 11:69495150-69495172
Sequence TCCTGTCCATGCTTTCCTGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1084494287_1084494291 -9 Left 1084494287 11:69495150-69495172 CCAGCAGGAAAGCATGGACAGGA No data
Right 1084494291 11:69495164-69495186 TGGACAGGAACCAGAGGGGCTGG No data
1084494287_1084494292 0 Left 1084494287 11:69495150-69495172 CCAGCAGGAAAGCATGGACAGGA No data
Right 1084494292 11:69495173-69495195 ACCAGAGGGGCTGGAACCTCTGG No data
1084494287_1084494298 18 Left 1084494287 11:69495150-69495172 CCAGCAGGAAAGCATGGACAGGA No data
Right 1084494298 11:69495191-69495213 TCTGGAGACCTGGTAGGGAAAGG No data
1084494287_1084494295 12 Left 1084494287 11:69495150-69495172 CCAGCAGGAAAGCATGGACAGGA No data
Right 1084494295 11:69495185-69495207 GGAACCTCTGGAGACCTGGTAGG No data
1084494287_1084494296 13 Left 1084494287 11:69495150-69495172 CCAGCAGGAAAGCATGGACAGGA No data
Right 1084494296 11:69495186-69495208 GAACCTCTGGAGACCTGGTAGGG No data
1084494287_1084494294 8 Left 1084494287 11:69495150-69495172 CCAGCAGGAAAGCATGGACAGGA No data
Right 1084494294 11:69495181-69495203 GGCTGGAACCTCTGGAGACCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1084494287 Original CRISPR TCCTGTCCATGCTTTCCTGC TGG (reversed) Intergenic