ID: 1084495326

View in Genome Browser
Species Human (GRCh38)
Location 11:69500107-69500129
Sequence CGCCTCCGGCAGCACTGTGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1084495319_1084495326 18 Left 1084495319 11:69500066-69500088 CCACCAGGCAGCGTGTTACAACA No data
Right 1084495326 11:69500107-69500129 CGCCTCCGGCAGCACTGTGATGG No data
1084495320_1084495326 15 Left 1084495320 11:69500069-69500091 CCAGGCAGCGTGTTACAACACAC No data
Right 1084495326 11:69500107-69500129 CGCCTCCGGCAGCACTGTGATGG No data
1084495321_1084495326 -7 Left 1084495321 11:69500091-69500113 CCATGTTGCCTTCCCGCGCCTCC No data
Right 1084495326 11:69500107-69500129 CGCCTCCGGCAGCACTGTGATGG No data
1084495318_1084495326 19 Left 1084495318 11:69500065-69500087 CCCACCAGGCAGCGTGTTACAAC No data
Right 1084495326 11:69500107-69500129 CGCCTCCGGCAGCACTGTGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1084495326 Original CRISPR CGCCTCCGGCAGCACTGTGA TGG Intergenic
No off target data available for this crispr