ID: 1084497829

View in Genome Browser
Species Human (GRCh38)
Location 11:69515318-69515340
Sequence GCTGCCTGAAGTCACCATGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1084497829_1084497837 25 Left 1084497829 11:69515318-69515340 CCCACATGGTGACTTCAGGCAGC No data
Right 1084497837 11:69515366-69515388 CCTGCACAGGTGCCCTGAGCTGG No data
1084497829_1084497834 12 Left 1084497829 11:69515318-69515340 CCCACATGGTGACTTCAGGCAGC No data
Right 1084497834 11:69515353-69515375 TCCATACAGGAGACCTGCACAGG No data
1084497829_1084497831 -1 Left 1084497829 11:69515318-69515340 CCCACATGGTGACTTCAGGCAGC No data
Right 1084497831 11:69515340-69515362 CTCCACCGAGCACTCCATACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1084497829 Original CRISPR GCTGCCTGAAGTCACCATGT GGG (reversed) Intergenic
No off target data available for this crispr