ID: 1084503824 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 11:69553005-69553027 |
| Sequence | CTGTCAAGGTACATGTGTCT GGG |
| Strand | + |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | No data | |||
| Summary | No data |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1084503820_1084503824 | -8 | Left | 1084503820 | 11:69552990-69553012 | CCTAGGATTTGCTTCCTGTCAAG | No data | ||
| Right | 1084503824 | 11:69553005-69553027 | CTGTCAAGGTACATGTGTCTGGG | No data | ||||
| 1084503817_1084503824 | 22 | Left | 1084503817 | 11:69552960-69552982 | CCTAGGATTTGGGGTATCGGGTG | No data | ||
| Right | 1084503824 | 11:69553005-69553027 | CTGTCAAGGTACATGTGTCTGGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1084503824 | Original CRISPR | CTGTCAAGGTACATGTGTCT GGG | Intergenic | ||
| No off target data available for this crispr | |||||