ID: 1084503824

View in Genome Browser
Species Human (GRCh38)
Location 11:69553005-69553027
Sequence CTGTCAAGGTACATGTGTCT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1084503820_1084503824 -8 Left 1084503820 11:69552990-69553012 CCTAGGATTTGCTTCCTGTCAAG No data
Right 1084503824 11:69553005-69553027 CTGTCAAGGTACATGTGTCTGGG No data
1084503817_1084503824 22 Left 1084503817 11:69552960-69552982 CCTAGGATTTGGGGTATCGGGTG No data
Right 1084503824 11:69553005-69553027 CTGTCAAGGTACATGTGTCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1084503824 Original CRISPR CTGTCAAGGTACATGTGTCT GGG Intergenic
No off target data available for this crispr