ID: 1084503984

View in Genome Browser
Species Human (GRCh38)
Location 11:69553785-69553807
Sequence GCACCCTTTTTGGCCAAGAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1084503984_1084504000 29 Left 1084503984 11:69553785-69553807 CCTGTCTTGGCCAAAAAGGGTGC No data
Right 1084504000 11:69553837-69553859 TGGTTATGGATGTGGAGTGGGGG No data
1084503984_1084503993 15 Left 1084503984 11:69553785-69553807 CCTGTCTTGGCCAAAAAGGGTGC No data
Right 1084503993 11:69553823-69553845 TAAGCCGTGGGGCCTGGTTATGG No data
1084503984_1084503992 9 Left 1084503984 11:69553785-69553807 CCTGTCTTGGCCAAAAAGGGTGC No data
Right 1084503992 11:69553817-69553839 GGTGATTAAGCCGTGGGGCCTGG No data
1084503984_1084503998 27 Left 1084503984 11:69553785-69553807 CCTGTCTTGGCCAAAAAGGGTGC No data
Right 1084503998 11:69553835-69553857 CCTGGTTATGGATGTGGAGTGGG No data
1084503984_1084503995 21 Left 1084503984 11:69553785-69553807 CCTGTCTTGGCCAAAAAGGGTGC No data
Right 1084503995 11:69553829-69553851 GTGGGGCCTGGTTATGGATGTGG No data
1084503984_1084503990 3 Left 1084503984 11:69553785-69553807 CCTGTCTTGGCCAAAAAGGGTGC No data
Right 1084503990 11:69553811-69553833 TGGCAGGGTGATTAAGCCGTGGG No data
1084503984_1084503991 4 Left 1084503984 11:69553785-69553807 CCTGTCTTGGCCAAAAAGGGTGC No data
Right 1084503991 11:69553812-69553834 GGCAGGGTGATTAAGCCGTGGGG No data
1084503984_1084503996 26 Left 1084503984 11:69553785-69553807 CCTGTCTTGGCCAAAAAGGGTGC No data
Right 1084503996 11:69553834-69553856 GCCTGGTTATGGATGTGGAGTGG No data
1084503984_1084503989 2 Left 1084503984 11:69553785-69553807 CCTGTCTTGGCCAAAAAGGGTGC No data
Right 1084503989 11:69553810-69553832 GTGGCAGGGTGATTAAGCCGTGG No data
1084503984_1084503999 28 Left 1084503984 11:69553785-69553807 CCTGTCTTGGCCAAAAAGGGTGC No data
Right 1084503999 11:69553836-69553858 CTGGTTATGGATGTGGAGTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1084503984 Original CRISPR GCACCCTTTTTGGCCAAGAC AGG (reversed) Intergenic
No off target data available for this crispr