ID: 1084504128

View in Genome Browser
Species Human (GRCh38)
Location 11:69554466-69554488
Sequence CCTTTTTATTGCATCTTCTC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1084504128_1084504132 -9 Left 1084504128 11:69554466-69554488 CCCGAGAAGATGCAATAAAAAGG No data
Right 1084504132 11:69554480-69554502 ATAAAAAGGACAACCTAGCCGGG No data
1084504128_1084504139 26 Left 1084504128 11:69554466-69554488 CCCGAGAAGATGCAATAAAAAGG No data
Right 1084504139 11:69554515-69554537 CGCCTGTAATCCCAGCACTTTGG 0: 121435
1: 268139
2: 223994
3: 153979
4: 220861
1084504128_1084504142 30 Left 1084504128 11:69554466-69554488 CCCGAGAAGATGCAATAAAAAGG No data
Right 1084504142 11:69554519-69554541 TGTAATCCCAGCACTTTGGGAGG 0: 288135
1: 266162
2: 155564
3: 133776
4: 191789
1084504128_1084504134 -1 Left 1084504128 11:69554466-69554488 CCCGAGAAGATGCAATAAAAAGG No data
Right 1084504134 11:69554488-69554510 GACAACCTAGCCGGGTGCGGTGG No data
1084504128_1084504140 27 Left 1084504128 11:69554466-69554488 CCCGAGAAGATGCAATAAAAAGG No data
Right 1084504140 11:69554516-69554538 GCCTGTAATCCCAGCACTTTGGG 0: 215700
1: 270647
2: 186590
3: 142154
4: 223611
1084504128_1084504131 -10 Left 1084504128 11:69554466-69554488 CCCGAGAAGATGCAATAAAAAGG No data
Right 1084504131 11:69554479-69554501 AATAAAAAGGACAACCTAGCCGG No data
1084504128_1084504133 -4 Left 1084504128 11:69554466-69554488 CCCGAGAAGATGCAATAAAAAGG No data
Right 1084504133 11:69554485-69554507 AAGGACAACCTAGCCGGGTGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1084504128 Original CRISPR CCTTTTTATTGCATCTTCTC GGG (reversed) Intergenic
No off target data available for this crispr