ID: 1084505586

View in Genome Browser
Species Human (GRCh38)
Location 11:69564870-69564892
Sequence CCTTAGGATAAATTCCTAGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1084505586_1084505592 26 Left 1084505586 11:69564870-69564892 CCCTCTAGGAATTTATCCTAAGG No data
Right 1084505592 11:69564919-69564941 GCATGTACAAGATCACATGGTGG No data
1084505586_1084505591 23 Left 1084505586 11:69564870-69564892 CCCTCTAGGAATTTATCCTAAGG No data
Right 1084505591 11:69564916-69564938 GATGCATGTACAAGATCACATGG No data
1084505586_1084505589 -9 Left 1084505586 11:69564870-69564892 CCCTCTAGGAATTTATCCTAAGG No data
Right 1084505589 11:69564884-69564906 ATCCTAAGGAAATGAGCAGACGG No data
1084505586_1084505593 27 Left 1084505586 11:69564870-69564892 CCCTCTAGGAATTTATCCTAAGG No data
Right 1084505593 11:69564920-69564942 CATGTACAAGATCACATGGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1084505586 Original CRISPR CCTTAGGATAAATTCCTAGA GGG (reversed) Intergenic
No off target data available for this crispr