ID: 1084505588

View in Genome Browser
Species Human (GRCh38)
Location 11:69564871-69564893
Sequence TCCTTAGGATAAATTCCTAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1084505588_1084505589 -10 Left 1084505588 11:69564871-69564893 CCTCTAGGAATTTATCCTAAGGA No data
Right 1084505589 11:69564884-69564906 ATCCTAAGGAAATGAGCAGACGG No data
1084505588_1084505593 26 Left 1084505588 11:69564871-69564893 CCTCTAGGAATTTATCCTAAGGA No data
Right 1084505593 11:69564920-69564942 CATGTACAAGATCACATGGTGGG No data
1084505588_1084505591 22 Left 1084505588 11:69564871-69564893 CCTCTAGGAATTTATCCTAAGGA No data
Right 1084505591 11:69564916-69564938 GATGCATGTACAAGATCACATGG No data
1084505588_1084505592 25 Left 1084505588 11:69564871-69564893 CCTCTAGGAATTTATCCTAAGGA No data
Right 1084505592 11:69564919-69564941 GCATGTACAAGATCACATGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1084505588 Original CRISPR TCCTTAGGATAAATTCCTAG AGG (reversed) Intergenic
No off target data available for this crispr