ID: 1084505593

View in Genome Browser
Species Human (GRCh38)
Location 11:69564920-69564942
Sequence CATGTACAAGATCACATGGT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1084505588_1084505593 26 Left 1084505588 11:69564871-69564893 CCTCTAGGAATTTATCCTAAGGA No data
Right 1084505593 11:69564920-69564942 CATGTACAAGATCACATGGTGGG No data
1084505586_1084505593 27 Left 1084505586 11:69564870-69564892 CCCTCTAGGAATTTATCCTAAGG No data
Right 1084505593 11:69564920-69564942 CATGTACAAGATCACATGGTGGG No data
1084505590_1084505593 11 Left 1084505590 11:69564886-69564908 CCTAAGGAAATGAGCAGACGGAT No data
Right 1084505593 11:69564920-69564942 CATGTACAAGATCACATGGTGGG No data
1084505585_1084505593 28 Left 1084505585 11:69564869-69564891 CCCCTCTAGGAATTTATCCTAAG No data
Right 1084505593 11:69564920-69564942 CATGTACAAGATCACATGGTGGG No data
1084505584_1084505593 29 Left 1084505584 11:69564868-69564890 CCCCCTCTAGGAATTTATCCTAA No data
Right 1084505593 11:69564920-69564942 CATGTACAAGATCACATGGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1084505593 Original CRISPR CATGTACAAGATCACATGGT GGG Intergenic
No off target data available for this crispr