ID: 1084508614

View in Genome Browser
Species Human (GRCh38)
Location 11:69587365-69587387
Sequence GGGATGCTTTGGGTTTTAGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1084508614_1084508621 0 Left 1084508614 11:69587365-69587387 CCTGCTAAAACCCAAAGCATCCC No data
Right 1084508621 11:69587388-69587410 TGGGCACCTGCCCCTGTGTCTGG No data
1084508614_1084508626 24 Left 1084508614 11:69587365-69587387 CCTGCTAAAACCCAAAGCATCCC No data
Right 1084508626 11:69587412-69587434 GAAGCCCTCCCTGACATCCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1084508614 Original CRISPR GGGATGCTTTGGGTTTTAGC AGG (reversed) Intergenic
No off target data available for this crispr