ID: 1084519261

View in Genome Browser
Species Human (GRCh38)
Location 11:69653595-69653617
Sequence CACGCACGCGGCCTCGGGGC CGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 119
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 110}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1084519261_1084519266 -10 Left 1084519261 11:69653595-69653617 CCGGCCCCGAGGCCGCGTGCGTG 0: 1
1: 0
2: 0
3: 8
4: 110
Right 1084519266 11:69653608-69653630 CGCGTGCGTGAGAACCGCGCCGG 0: 1
1: 0
2: 0
3: 1
4: 29
1084519261_1084519268 7 Left 1084519261 11:69653595-69653617 CCGGCCCCGAGGCCGCGTGCGTG 0: 1
1: 0
2: 0
3: 8
4: 110
Right 1084519268 11:69653625-69653647 CGCCGGTGTCCCCAGAGACCAGG 0: 1
1: 0
2: 3
3: 14
4: 141

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1084519261 Original CRISPR CACGCACGCGGCCTCGGGGC CGG (reversed) Exonic
900100240 1:959379-959401 AACGCCGGCGGCCTCAGGGCGGG + Intergenic
900245504 1:1634366-1634388 CCCGCGGGCGGCCTTGGGGCAGG + Intronic
900256735 1:1701525-1701547 CCCGCGGGCGGCCTTGGGGCAGG + Intronic
900613735 1:3555114-3555136 CACGCACGGGGCCTGCTGGCCGG + Intronic
901021971 1:6260455-6260477 CTCGGACGCGCCCTCGGGGTGGG - Intronic
903353778 1:22734016-22734038 CACTCCTGCGGCCTCTGGGCTGG - Intronic
906521259 1:46468426-46468448 CATGCACGCAGCATGGGGGCTGG - Intergenic
912955626 1:114152909-114152931 CTCGGACTCGGACTCGGGGCCGG - Exonic
1072253704 10:93601142-93601164 CGCGGCCGGGGCCTCGGGGCCGG - Intronic
1072757483 10:98030591-98030613 CGAGCGCGCGGCGTCGGGGCGGG - Exonic
1076516069 10:131045094-131045116 CCAGCACGTGGCCTCGGGCCGGG - Intergenic
1076935536 10:133566063-133566085 CGGGAACGCGGCCTAGGGGCAGG - Intronic
1077143271 11:1034148-1034170 CACCCAGGCGGCCAAGGGGCAGG - Intronic
1077367918 11:2168607-2168629 CCAGCTCGCGGCCTCTGGGCGGG + Exonic
1079210386 11:18455799-18455821 CCCGCACGCGGGGGCGGGGCGGG + Intergenic
1079430874 11:20387536-20387558 CCCGCACGGCGCCTCGAGGCCGG + Exonic
1080418621 11:32091551-32091573 CGCGCGCGCGGCCTCGAGGATGG + Intronic
1083766789 11:64845073-64845095 GACGCCCGCGGCCCCGGAGCCGG + Intergenic
1083890253 11:65592384-65592406 CACGCGCGCGGCCTCCGGGACGG - Exonic
1084519261 11:69653595-69653617 CACGCACGCGGCCTCGGGGCCGG - Exonic
1089374729 11:117986301-117986323 CCCGTCCGCGGCCTCGGGGGCGG + Intergenic
1092196928 12:6555407-6555429 CACGCCCGCCGGCTCGGGCCGGG - Exonic
1092793225 12:12087343-12087365 CAGGCACGTGGCCTTGGAGCTGG - Exonic
1097023139 12:56034881-56034903 CAGTCAGGGGGCCTCGGGGCCGG - Exonic
1105539799 13:21306553-21306575 CAGGCACTGGGCCTCAGGGCTGG + Intergenic
1107133535 13:36920398-36920420 CGCGCACGTGGCCGTGGGGCCGG - Intronic
1113771461 13:112911669-112911691 CGCGCCCTCGGCCTCGGGGAAGG - Intronic
1115651294 14:35404352-35404374 GACGCGCGCGGCCTGGGGGTGGG - Intronic
1117176764 14:53153338-53153360 GGCGCACGCGGCCGGGGGGCGGG - Intergenic
1121632737 14:95432851-95432873 CACCCACGCGGCCTCGGGCAAGG + Intronic
1122235804 14:100330095-100330117 CAGGCTGGGGGCCTCGGGGCGGG + Exonic
1123043441 14:105499850-105499872 AATGGACGTGGCCTCGGGGCAGG - Intergenic
1124629167 15:31327310-31327332 CACGGCCGCGCCCTCGGGCCGGG - Exonic
1125462409 15:39919949-39919971 CACACCCGCAGCCTCGGCGCCGG + Exonic
1125731025 15:41892944-41892966 CACGCAGGCGGCCCCGGCTCGGG + Exonic
1125756717 15:42069958-42069980 CAGGATCGGGGCCTCGGGGCAGG + Exonic
1131035149 15:89217231-89217253 GGCGCAGGCGGCCTCGGGGGAGG - Exonic
1132512595 16:352018-352040 CCGGCACGCGGCCTCGGCGAGGG + Intronic
1132541062 16:510024-510046 GAGGCACGGGGCCTCGGGACGGG - Intronic
1132612782 16:825494-825516 CAAGCACGCGGCCTCGGTTCAGG + Intergenic
1133304929 16:4802711-4802733 CACGGAGCCGGCCTGGGGGCGGG - Exonic
1139633525 16:68244839-68244861 CACCCAGGTGCCCTCGGGGCAGG + Intergenic
1141526449 16:84614878-84614900 CAGGCAGGCTGGCTCGGGGCAGG - Intronic
1141811186 16:86377543-86377565 CCAGCACGCGGCCTCAGGCCTGG + Intergenic
1142000534 16:87661731-87661753 CCCGCAGGCCGCCACGGGGCGGG + Intronic
1142271844 16:89093968-89093990 GACGGCCGCGGCCACGGGGCAGG - Exonic
1143579924 17:7819433-7819455 CAGCCACTCGGCCTCCGGGCTGG - Intronic
1148688092 17:49512030-49512052 CACGCAGACAGCCTCGGGCCAGG + Exonic
1148843595 17:50515221-50515243 CACGCCCGCCGACTCAGGGCTGG + Intronic
1149643287 17:58219114-58219136 AAAGCATGGGGCCTCGGGGCTGG + Intronic
1152732117 17:81977558-81977580 CAGCCACGCGGCCAGGGGGCGGG - Exonic
1155199431 18:23503898-23503920 CTCGCAGGTGACCTCGGGGCTGG + Intronic
1158259091 18:55588072-55588094 CATGAACGCCGCCTCGGCGCCGG - Intronic
1159045793 18:63367396-63367418 CACTCCCCCGGCCTCGGGACGGG + Exonic
1160992153 19:1864256-1864278 CGCGCACGTGGCCTGGGGGCGGG - Intergenic
1161016877 19:1987576-1987598 CACGCAGGCAGCAGCGGGGCCGG + Exonic
1161169968 19:2807752-2807774 GAGGGACGCGGCCTCGGGGGAGG + Exonic
1161265157 19:3360342-3360364 CGCGCGCGCGGCAGCGGGGCCGG - Intronic
1161595235 19:5147944-5147966 CAGGCCCTTGGCCTCGGGGCAGG - Intronic
1161949910 19:7462252-7462274 CACGGAATAGGCCTCGGGGCTGG - Exonic
1162022578 19:7874423-7874445 CCCGCCCGCGGCCGAGGGGCGGG - Exonic
1162176291 19:8832558-8832580 GCCGCACGAGGCCTGGGGGCGGG + Intronic
1162435366 19:10654764-10654786 CCCGCACGCGGCCCCTCGGCCGG + Intronic
1163441188 19:17323535-17323557 CCAGCACACGGCCTGGGGGCTGG + Exonic
1165058746 19:33194791-33194813 GAAGCGCGCGGCCGCGGGGCTGG + Exonic
1166363699 19:42268180-42268202 AACGCGCGCGGCCTGGGGCCCGG - Intergenic
929681287 2:43995792-43995814 CACTCACCCGGCCACGGGCCCGG + Exonic
938302968 2:130229218-130229240 AGCGCCCGCGGCCTCCGGGCGGG - Intergenic
947669332 2:231926484-231926506 CACGCACGCGGCCGCGCCGAGGG + Intergenic
948824718 2:240568618-240568640 GACGGGCGCGGCCTCGGCGCCGG - Intronic
1169211531 20:3768392-3768414 AAGGCACGCGGGCTGGGGGCTGG + Intergenic
1170315011 20:15032063-15032085 CACACACGCGGCCAGGTGGCAGG + Intronic
1178265994 21:31143029-31143051 GACACACGCTGCCTCTGGGCTGG + Intronic
1178279272 21:31266834-31266856 CAGGCACGCTTCCTCGGGGAAGG - Exonic
1178992371 21:37366685-37366707 CCCGCCCGCCGGCTCGGGGCTGG + Intronic
1181017670 22:20080471-20080493 CCCGCCCGCGGCCTCGGTCCCGG - Intronic
1181512337 22:23394563-23394585 CACGCAGGGGGCCTGGGGGCTGG - Intergenic
1182226151 22:28800366-28800388 CCCGCTCGCTGCCTCCGGGCTGG + Exonic
1183355248 22:37355347-37355369 CCCGCAGGTGGCCTCGGGCCCGG - Intergenic
1183649555 22:39145970-39145992 GACGCAGGCGGCCTTGGGGCAGG + Intronic
1184276429 22:43411827-43411849 CGCGCTCGCGGCCTCGGTCCCGG - Intronic
1184523723 22:45009636-45009658 GGCGGACGCGGCCTCCGGGCTGG + Exonic
1184682287 22:46078843-46078865 CACGCACACGGCCACGTGACTGG - Intronic
950131756 3:10552146-10552168 CACGGCCGCCGCCTCGGTGCCGG + Intronic
950618128 3:14178636-14178658 CAAGCGCACCGCCTCGGGGCGGG - Exonic
968554847 4:1241732-1241754 CAGGGGCGCGGCCTCGGGCCTGG - Intronic
968636699 4:1684542-1684564 CACGCACGCGCGCAGGGGGCGGG - Intergenic
969873065 4:10116571-10116593 CCCGCACGGCGCCTAGGGGCCGG + Intronic
975778765 4:77818902-77818924 CACACGCGCGGCAGCGGGGCTGG - Intronic
976569806 4:86594717-86594739 CAGGGACGCGGCGTCGGGGCGGG - Exonic
978741907 4:112145946-112145968 CAGACACGCGACCCCGGGGCCGG - Intronic
985068444 4:186144973-186144995 CGCCCCCGCGGCCCCGGGGCTGG - Exonic
986272465 5:6245847-6245869 CACGCATGGGACTTCGGGGCTGG + Intergenic
990003599 5:50922074-50922096 CCCACACGCCCCCTCGGGGCTGG - Intergenic
1003092875 6:3118826-3118848 CCCGAACGCGGCCGCGGGTCCGG - Exonic
1006294034 6:33161875-33161897 CGCATCCGCGGCCTCGGGGCGGG - Intergenic
1008587453 6:52962578-52962600 CACCCACGTGGCCTCAGTGCAGG - Intergenic
1012895398 6:104941021-104941043 CACTCGCGCGGCCGCGGGGCCGG - Intergenic
1017712970 6:157186420-157186442 CCTGCACGCGCTCTCGGGGCTGG - Intronic
1029849331 7:103446068-103446090 CGCGCGGGCGGCCGCGGGGCCGG - Intronic
1033300061 7:140177230-140177252 CACGCAGGCGGCTGCGGGGGCGG + Intergenic
1034179645 7:149126973-149126995 CCCGCAGGCGGCCCCGAGGCCGG - Intronic
1034222893 7:149459863-149459885 CACACACGCGGCCCCGAGGTGGG - Intronic
1034342728 7:150368716-150368738 CGCGGCCGCGGCCTGGGGGCGGG - Intronic
1035038123 7:155908540-155908562 CAGGGACCCTGCCTCGGGGCTGG - Intergenic
1037305221 8:17497259-17497281 CTCGCCCGCGGCCTCTCGGCGGG - Intronic
1049179386 8:141213700-141213722 CAAGCACGCGGACACGTGGCAGG + Intronic
1049509002 8:143018477-143018499 CAGCCGCGCGGCCCCGGGGCGGG - Intronic
1049598885 8:143498103-143498125 CACGCACCGGGGCCCGGGGCAGG + Intronic
1049748515 8:144272996-144273018 CATGCAGGCGGCCGCGGGGGTGG + Intronic
1049769851 8:144374712-144374734 CCCGCCCGCCGCCTCAGGGCAGG - Intronic
1049955260 9:687222-687244 AATGCTCGCAGCCTCGGGGCTGG - Intronic
1056702700 9:88924270-88924292 CACACACACGGCCTCTGGGGTGG + Intergenic
1057437487 9:95055780-95055802 CATGCAGGCGGCCTTCGGGCAGG - Intronic
1060177305 9:121506396-121506418 CAAGCAGGAGGCCTCAGGGCAGG + Intergenic
1061296526 9:129679743-129679765 CAGGCAGGCGGGCTAGGGGCAGG + Intronic
1061764565 9:132873713-132873735 CACCCACTCGGCCTCAGGGTGGG + Intronic
1187419515 X:19122444-19122466 GCCGCTCGCGTCCTCGGGGCTGG + Exonic
1200787620 Y:7273969-7273991 CGCGCACGCGGCCACCGAGCTGG + Intergenic