ID: 1084519536

View in Genome Browser
Species Human (GRCh38)
Location 11:69655077-69655099
Sequence CCGTGTCAGGGCCATGATCC GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 138
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 130}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1084519531_1084519536 -7 Left 1084519531 11:69655061-69655083 CCGGGAGAGCAAAGCACCGTGTC 0: 1
1: 0
2: 0
3: 11
4: 73
Right 1084519536 11:69655077-69655099 CCGTGTCAGGGCCATGATCCGGG 0: 1
1: 0
2: 0
3: 7
4: 130
1084519527_1084519536 12 Left 1084519527 11:69655042-69655064 CCTTTGGCGACGCCAGGCTCCGG 0: 1
1: 0
2: 1
3: 6
4: 41
Right 1084519536 11:69655077-69655099 CCGTGTCAGGGCCATGATCCGGG 0: 1
1: 0
2: 0
3: 7
4: 130
1084519530_1084519536 0 Left 1084519530 11:69655054-69655076 CCAGGCTCCGGGAGAGCAAAGCA 0: 1
1: 0
2: 1
3: 17
4: 177
Right 1084519536 11:69655077-69655099 CCGTGTCAGGGCCATGATCCGGG 0: 1
1: 0
2: 0
3: 7
4: 130

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1084519536 Original CRISPR CCGTGTCAGGGCCATGATCC GGG Intronic
901377415 1:8849231-8849253 CCTGGTCAGGGCCCTCATCCTGG - Intergenic
901965535 1:12863109-12863131 CCTTGACAGGGTCATGAGCCAGG + Intronic
902458659 1:16554508-16554530 GCGTGTGAGGGCCAGGAGCCAGG + Intergenic
902493498 1:16853408-16853430 GCGTGTGAGGGCCAGGAGCCAGG - Intronic
906689900 1:47785648-47785670 CCATGTCAAGGCCCAGATCCAGG + Intronic
910338015 1:86155688-86155710 CAGTGACAGGGCAATGATCAGGG + Intronic
911150146 1:94590559-94590581 CCATGCCAGGTCCATGTTCCTGG + Intergenic
911639057 1:100267517-100267539 CCTTGTCAGGACCTTGATCTTGG - Exonic
912435131 1:109656382-109656404 CAGTGTCATGGACATGATGCTGG - Exonic
913957789 1:143320195-143320217 CCTTGGCAGGGCCAGGTTCCAGG + Intergenic
914052099 1:144145559-144145581 CCTTGGCAGGGCCAGGTTCCAGG + Intergenic
914127098 1:144820982-144821004 CCTTGGCAGGGCCAGGTTCCAGG - Intergenic
915341267 1:155178124-155178146 CCGTCTCAGCGCCCAGATCCAGG + Exonic
916739573 1:167636465-167636487 CCATGTCAGGGCCAACCTCCTGG + Intronic
917709116 1:177666403-177666425 CTGTTTCAGGGCCCTGATCTGGG + Intergenic
1063188480 10:3671146-3671168 CCTGGCTAGGGCCATGATCCAGG - Intergenic
1063396465 10:5692708-5692730 CCGAGTCAGGGCCATGCCCCTGG + Intronic
1066755024 10:38703133-38703155 CCGTCTCAGTGCGATGAACCAGG - Intergenic
1066961732 10:42232365-42232387 CCTTGGCAGGGCCAGGTTCCAGG + Intergenic
1070808803 10:79286928-79286950 CCGTCTCAAGGCCATCAGCCTGG + Intronic
1072747927 10:97954648-97954670 CCATGTCGGGGCAATGACCCCGG + Intronic
1077285204 11:1762511-1762533 GCTTGTCAGGGGCGTGATCCCGG + Intronic
1079012588 11:16841581-16841603 TTGGGTCAGGGCCATGAACCAGG - Exonic
1084519536 11:69655077-69655099 CCGTGTCAGGGCCATGATCCGGG + Intronic
1089261967 11:117229725-117229747 CCCTGCCAGGCCCATGACCCAGG + Exonic
1089678917 11:120108706-120108728 CACTGTCAGGGCCAGAATCCTGG - Intergenic
1092160412 12:6312516-6312538 CAGTGACAGGGCCAGGCTCCAGG + Intronic
1094425818 12:30316128-30316150 CCCTGACAGGACCTTGATCCTGG - Intergenic
1095988647 12:48017999-48018021 CCCTGTCAGGGCCAGGCTCAGGG - Intergenic
1097152183 12:56987221-56987243 CCCTGTCAGGGCCCACATCCAGG + Intergenic
1104013170 12:124946563-124946585 CCAAGGCAGGGCCATGAGCCAGG - Intergenic
1105018217 12:132798990-132799012 CCTCCTCAGGGCCATGGTCCTGG - Intronic
1114422756 14:22598365-22598387 CTCTCTCTGGGCCATGATCCTGG + Intronic
1117499629 14:56339061-56339083 CAGTGTCAGGGCCACTCTCCAGG - Intergenic
1122905302 14:104798911-104798933 CCGGGGCAGGGCTGTGATCCAGG + Intergenic
1202930595 14_KI270725v1_random:29895-29917 CCTTGGCAGGGCCAGGTTCCAGG - Intergenic
1123421762 15:20141522-20141544 CCTTGGCAGGGCCAGGTTCCAGG + Intergenic
1123443303 15:20305015-20305037 CCTTGGCAGGGCCAGGTTCCAGG - Intergenic
1123530988 15:21148062-21148084 CCTTGGCAGGGCCAGGTTCCAGG + Intergenic
1129737812 15:77975693-77975715 CCGTGTCTGAGCCCAGATCCTGG - Intergenic
1132763947 16:1525075-1525097 CCATGCCAGGGCCCTGAGCCAGG - Intronic
1133564688 16:6982394-6982416 CAGAGTCAGGGCTCTGATCCTGG + Intronic
1134442872 16:14309740-14309762 CCCTGCCAAGGCGATGATCCCGG - Intergenic
1134672254 16:16064485-16064507 CCCTTTCAGGTCCATGGTCCTGG - Intronic
1136722918 16:32338873-32338895 CCTTGGCAGGGCCAAGTTCCAGG + Intergenic
1136841240 16:33544872-33544894 CCTTGGCAGGGCCAAGTTCCAGG + Intergenic
1136863083 16:33714135-33714157 CCTTGGCAGGGCCAAGTTCCAGG - Intergenic
1141141414 16:81499125-81499147 TCGTGTCAGGGCCAAGAGCCTGG - Intronic
1203003513 16_KI270728v1_random:178891-178913 CCTTGGCAGGGCCAAGTTCCAGG - Intergenic
1203124567 16_KI270728v1_random:1562288-1562310 CCTTGGCAGGGCCAGGTTCCAGG - Intergenic
1203135121 16_KI270728v1_random:1715298-1715320 CCTTGGCAGGGCCAAGTTCCAGG - Intergenic
1203151405 16_KI270728v1_random:1845169-1845191 CCTTGGCAGGGCCAAGTTCCAGG + Intergenic
1143302698 17:5922516-5922538 CTGTGTCAGGCCGATGAGCCTGG - Intronic
1145019072 17:19415946-19415968 CCCTGCCAGGCCCATGAGCCCGG - Exonic
1146717645 17:35099846-35099868 CCGTCTGAGAGCCATGACCCTGG - Intronic
1147247360 17:39131227-39131249 CTGTGTCAGGACCAAGATCGAGG + Intronic
1151833715 17:76570095-76570117 CCGTTTCATGGGCATGACCCTGG + Intronic
1155838230 18:30613764-30613786 CTGTGTCAGGGGCATGAGGCTGG - Intergenic
1159479789 18:68974340-68974362 ACGTGCCAGTGCCTTGATCCTGG + Intronic
1162369611 19:10270891-10270913 CGGTGGCAGGGCGATGACCCCGG - Exonic
1165383776 19:35498637-35498659 CCGGGGCAGGGCCAGGATCTTGG - Intronic
1166269585 19:41705752-41705774 TGGTGACAGGGCAATGATCCAGG + Intronic
1202691498 1_KI270712v1_random:97983-98005 CCTTGGCAGGGCCAGGTTCCAGG + Intergenic
931231548 2:60379378-60379400 CAGTGTCAGAGCCATGATTCAGG + Intergenic
932266207 2:70369027-70369049 CCCTGTCAGAGACAGGATCCGGG - Intergenic
932579928 2:72986463-72986485 CAGGGTCAGGACCATGAGCCTGG + Intronic
933809905 2:86026779-86026801 CAGTGGCAGGGCCAGGACCCTGG + Exonic
933954892 2:87355967-87355989 CCTTGGCAGGGCCAGGTTCCAGG - Intergenic
934219824 2:90072582-90072604 CTGTGTCATGGGTATGATCCAGG - Intergenic
934239081 2:90252181-90252203 CCTTGGCAGGGCCAGGTTCCAGG - Intergenic
934274102 2:91564517-91564539 CCTTGGCAGGGCCAGGTTCCAGG + Intergenic
934323207 2:91984744-91984766 CCTTGGCAGGGCCAGGTTCCAGG - Intergenic
934461521 2:94215535-94215557 CCTTGGCAGGGCCAGGTTCCAGG - Intergenic
936227958 2:110674936-110674958 CCGTGTCTCAGCCATGCTCCTGG - Intronic
938482320 2:131672526-131672548 CCGTGTCAGGGCTCTGGTGCAGG + Intergenic
939217570 2:139259588-139259610 CTGTGTCAAGGTCATGGTCCAGG - Intergenic
941864831 2:170324005-170324027 CCCTTTTATGGCCATGATCCTGG + Intronic
945421360 2:209641001-209641023 TTGTAACAGGGCCATGATCCAGG - Intronic
945855416 2:215063698-215063720 AAGTGTCAGGGCCATCATCCTGG - Intronic
946170720 2:217893774-217893796 CAGTGCCAGGGCCAAGACCCGGG - Intronic
948853790 2:240720843-240720865 CCGAGTCACGGCCATGGTCATGG + Intronic
1169335406 20:4751854-4751876 CCCAGTCAGGGCCATGTTCATGG - Intergenic
1176264189 20:64200142-64200164 CCGTGTCCTTGCCATGATGCTGG - Intronic
1176592608 21:8658496-8658518 CCTTGGCAGGGCCAGGTTCCAGG - Intergenic
1177929835 21:27267203-27267225 CCGTGACAGGGTCAAGAACCTGG - Intergenic
1180275464 22:10635638-10635660 CCTTGGCAGGGCCAGGTTCCAGG - Intergenic
1180549954 22:16530615-16530637 CCTTGGCAGGGCCAGGTTCCAGG - Intergenic
1180824107 22:18851304-18851326 CAGTGTCAGGGAAATGATCATGG + Intronic
1181124535 22:20694458-20694480 CTGTGTCAGGGAAATGATCATGG + Intergenic
1181188631 22:21123244-21123266 CAGTGTCAGGGAAATGATCATGG - Intergenic
1181210570 22:21287249-21287271 CAGTGTCAGGGAAATGATCATGG + Intergenic
1181354722 22:22291221-22291243 CCTTGGCAGGGCCAGGTTCCAGG + Intergenic
1181398942 22:22639642-22639664 CAGTGTCAGGGAAATGATCATGG - Intergenic
1181501671 22:23318988-23319010 CAGTGTCAGGGAAATGATCATGG - Intergenic
1181650479 22:24256417-24256439 CAGTGTCAGGGAAATGATCATGG + Intergenic
1181706901 22:24654321-24654343 CAGTGTCAGGGAAATGATCATGG - Intergenic
1203216378 22_KI270731v1_random:8181-8203 CAGTGTCAGGGAAATGATCATGG - Intergenic
1203274248 22_KI270734v1_random:77208-77230 CAGTGTCAGGGAAATGATCATGG + Intergenic
955961571 3:64346280-64346302 CTGTGGCAGGGGCATGCTCCAGG + Intronic
956146899 3:66199422-66199444 CAGTGTCAGGGCCAGGATAAGGG - Intronic
958977329 3:100682593-100682615 TCCAGTCAGGGCCATGAGCCAGG + Intronic
961617960 3:128198568-128198590 CAGTGACAGGGCCATGAGCTTGG + Intronic
962794149 3:138836103-138836125 CCGTGCCCGGCCAATGATCCTGG + Intergenic
964658188 3:159091312-159091334 CCGTGTCAGCACCCTGATCTTGG - Intronic
968752756 4:2398767-2398789 CAGTGGCAGGGGCAAGATCCAGG + Intronic
968752780 4:2398874-2398896 CAGTGGCAGGGGCAAGATCCAGG + Intronic
973588923 4:52420578-52420600 CCGGGTAAGGGCCAGGCTCCAGG + Intergenic
984760757 4:183360728-183360750 CCCTGACAGGGCCTTGATCTGGG + Intergenic
985694473 5:1332168-1332190 CCCAGCCAGGCCCATGATCCAGG - Intronic
985732286 5:1556102-1556124 CCATGTCCGGGTCATGATCCAGG + Intergenic
986502820 5:8417947-8417969 TCGTGTGAAGGCCATGCTCCAGG + Intergenic
1005503229 6:26448272-26448294 CCCTGCCAGGGCCGCGATCCAGG - Exonic
1005838127 6:29723297-29723319 CCGTGTCAGGTCCTTCTTCCTGG + Intronic
1017822738 6:158060892-158060914 CCCAGGCAGGGCCATGACCCAGG - Intronic
1026505704 7:70980746-70980768 GCGTGTCAGGGACACCATCCTGG + Intergenic
1031571964 7:123370163-123370185 CCATGTCAGAGCCATAAGCCAGG - Intergenic
1040306465 8:46214515-46214537 CCTTGTCATGGCCAAGATGCAGG + Intergenic
1046751633 8:117933023-117933045 CTGTCTCAGGGCCTTGATACTGG + Intronic
1049472509 8:142782762-142782784 CAGTCTCAGGGACATGACCCAGG - Intergenic
1049697951 8:143992884-143992906 CCGTGCCAGGGGCAGGGTCCAGG - Exonic
1052940168 9:34126543-34126565 CCGGGTCCGGGCCATTTTCCGGG - Exonic
1053691997 9:40591188-40591210 CCTTGGCAGGGCCAGGTTCCAGG - Intergenic
1054272803 9:63046297-63046319 CCTTGGCAGGGCCAGGTTCCAGG + Intergenic
1054303254 9:63392154-63392176 CCTTGGCAGGGCCAGGTTCCAGG - Intergenic
1054402033 9:64718664-64718686 CCTTGGCAGGGCCAGGTTCCAGG - Intergenic
1054435639 9:65202979-65203001 CCTTGGCAGGGCCAGGTTCCAGG - Intergenic
1054494754 9:65818708-65818730 CCTTGGCAGGGCCAGGTTCCAGG + Intergenic
1057298309 9:93861955-93861977 CCTTGTCAGGGCCCCCATCCCGG + Intergenic
1057847815 9:98539009-98539031 CCGTGTCGGGGCCCTCAGCCAGG - Intronic
1060238976 9:121887041-121887063 CCGTGACAGGCTCATCATCCTGG - Intronic
1061150663 9:128826329-128826351 CAGTGTCTGTGGCATGATCCAGG + Intronic
1061818148 9:133208266-133208288 CCGGGTCAGGGCCATGCACCAGG - Intronic
1062242309 9:135547093-135547115 CCGGGTCAGGGCCATGCACCAGG + Intronic
1062602515 9:137324228-137324250 CTGGGGCAGGGCCACGATCCGGG - Intronic
1203622661 Un_KI270749v1:137324-137346 CCTTGGCAGGGCCAGGTTCCAGG - Intergenic
1188315837 X:28672556-28672578 GGGTGCCAGGGCCCTGATCCAGG - Intronic
1192236696 X:69300666-69300688 CTGTGTCAGGGTCCTGGTCCTGG - Intergenic
1192562097 X:72134012-72134034 CCGGGGAAGGGCCATGAGCCAGG - Intronic