ID: 1084519615

View in Genome Browser
Species Human (GRCh38)
Location 11:69655429-69655451
Sequence AGGGCTCAACAGTGGGGCCG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 168
Summary {0: 1, 1: 0, 2: 1, 3: 8, 4: 158}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1084519599_1084519615 30 Left 1084519599 11:69655376-69655398 CCTTTATGAAGCACCTGCTGTCT 0: 1
1: 0
2: 2
3: 25
4: 238
Right 1084519615 11:69655429-69655451 AGGGCTCAACAGTGGGGCCGGGG 0: 1
1: 0
2: 1
3: 8
4: 158
1084519603_1084519615 1 Left 1084519603 11:69655405-69655427 CCTGCCTTGTAGAGCACTCCTCC 0: 1
1: 0
2: 2
3: 7
4: 137
Right 1084519615 11:69655429-69655451 AGGGCTCAACAGTGGGGCCGGGG 0: 1
1: 0
2: 1
3: 8
4: 158
1084519604_1084519615 -3 Left 1084519604 11:69655409-69655431 CCTTGTAGAGCACTCCTCCCAGG 0: 1
1: 0
2: 0
3: 14
4: 122
Right 1084519615 11:69655429-69655451 AGGGCTCAACAGTGGGGCCGGGG 0: 1
1: 0
2: 1
3: 8
4: 158
1084519602_1084519615 5 Left 1084519602 11:69655401-69655423 CCTTCCTGCCTTGTAGAGCACTC 0: 1
1: 0
2: 0
3: 13
4: 119
Right 1084519615 11:69655429-69655451 AGGGCTCAACAGTGGGGCCGGGG 0: 1
1: 0
2: 1
3: 8
4: 158
1084519600_1084519615 17 Left 1084519600 11:69655389-69655411 CCTGCTGTCTACCCTTCCTGCCT 0: 1
1: 1
2: 5
3: 55
4: 620
Right 1084519615 11:69655429-69655451 AGGGCTCAACAGTGGGGCCGGGG 0: 1
1: 0
2: 1
3: 8
4: 158
1084519601_1084519615 6 Left 1084519601 11:69655400-69655422 CCCTTCCTGCCTTGTAGAGCACT 0: 1
1: 0
2: 2
3: 17
4: 174
Right 1084519615 11:69655429-69655451 AGGGCTCAACAGTGGGGCCGGGG 0: 1
1: 0
2: 1
3: 8
4: 158

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1084519615 Original CRISPR AGGGCTCAACAGTGGGGCCG GGG Intronic
901055477 1:6447079-6447101 TGGGCTCAACGGTGGAGACGGGG - Intronic
901078618 1:6571178-6571200 AGGGCTCAGCAGGGCGGCTGTGG - Exonic
902078224 1:13803927-13803949 GGGGCTCAGCAGTGGGCCCATGG + Intronic
902571409 1:17349311-17349333 AGGGGACAACAATGGTGCCGAGG - Intronic
903404589 1:23085727-23085749 AGGGATCTGCAGTGGGGCCAAGG - Exonic
904448654 1:30597041-30597063 TGGGCTCTACAGAGGGGGCGAGG - Intergenic
904832172 1:33312257-33312279 AGGGCTCAGCACTGGGGAGGTGG - Intronic
905286031 1:36880916-36880938 AGGGGTCAGCACTGGGGCTGTGG + Intronic
906142842 1:43543981-43544003 GGAGCTCACCAGTGGGGCCAGGG + Intronic
910720307 1:90278888-90278910 AGTGCTCAACAGAGTGGCCTGGG + Intergenic
912491235 1:110063939-110063961 AGGGCTTCCCAGAGGGGCCGTGG - Intronic
920044331 1:203123801-203123823 AGGGCTCCACAGAGGAGCCTCGG - Intronic
924843425 1:247739052-247739074 CTGGCTCAACAGAGGGGCCTTGG + Exonic
1063238740 10:4146369-4146391 AGAGCTCAACAGAGAGGCCAGGG - Intergenic
1063606357 10:7526282-7526304 AGGGCCCAGCAGCGGGGCTGAGG - Intergenic
1067085764 10:43237400-43237422 GGGGCACAACAGTGGGGTCAGGG - Intronic
1067432287 10:46252396-46252418 AAGGCACAACAGTGGGGCCGGGG + Intergenic
1067688269 10:48480967-48480989 AGGGCACCACAGCGGGCCCGTGG + Intronic
1068428812 10:56905867-56905889 AGGGGTGAGCAGTGGGGCCCAGG + Intergenic
1072518480 10:96209887-96209909 AGGTCGAAACAGTGGGGCCTGGG - Exonic
1073196091 10:101693859-101693881 ATGGCTGAACACTGGGACCGAGG + Intronic
1075645209 10:124092448-124092470 AGGGGACAGCAGTGGGGGCGGGG + Intronic
1076864591 10:133160576-133160598 GGGGCCCCCCAGTGGGGCCGGGG - Intronic
1077164410 11:1128738-1128760 AGGGCTCCAGAGGGGGGCCGAGG + Intergenic
1078142006 11:8699681-8699703 GGGGCACATCAGTGGGCCCGTGG + Intronic
1079249001 11:18773513-18773535 GGGGCTCTTCAGTGGGGCTGGGG + Intronic
1084519615 11:69655429-69655451 AGGGCTCAACAGTGGGGCCGGGG + Intronic
1084881939 11:72177746-72177768 AGGGCTCAAAGGTGTGGCAGAGG - Intergenic
1085688465 11:78647042-78647064 AGGGCTGAACAGGTGGGCAGAGG - Intergenic
1088897939 11:114092025-114092047 AGGACTGAGCAGAGGGGCCGAGG + Intronic
1090173469 11:124625815-124625837 AGGGCCCAGCACTGGGGCTGAGG + Exonic
1090653690 11:128826635-128826657 AGGGGTCAGCAGAGGGGCCCAGG + Intergenic
1091063910 11:132490986-132491008 AGGACTCAAAAGTGAGTCCGAGG - Intronic
1091783891 12:3230840-3230862 AGGGGTCTCCAGGGGGGCCGAGG - Intronic
1092926847 12:13279276-13279298 AGGGCTCAACAGTGTTGCCCAGG - Intergenic
1096510542 12:52125549-52125571 AGGGAGAAACAGTGGGGACGGGG - Intergenic
1097046128 12:56189126-56189148 AGGGCGCAGCAGTGGGGGCGGGG + Intronic
1101611620 12:106297951-106297973 AGGGGACAACAGTGGTGCCCAGG + Intronic
1103301767 12:119933078-119933100 GGGGGTAAACAGTGGGGACGAGG + Intergenic
1105265469 13:18810550-18810572 AGGCCTCATCAGTGGGGACCTGG - Intergenic
1108747279 13:53408801-53408823 AGGGCCCAGAAGTGGGGTCGTGG + Intergenic
1112465033 13:99636544-99636566 ATGGCTCAACAGTGGGGAGCAGG - Intronic
1112506963 13:99981278-99981300 AGGGCTAAACACTGCGGCCGCGG + Intergenic
1113788627 13:113015893-113015915 ATGGCTCAAGAGAGGCGCCGTGG + Intronic
1116975188 14:51108236-51108258 AGGGGTCCAGAGTGGGGCAGGGG + Intergenic
1121563036 14:94888169-94888191 AGGGCTGAACTCTGGTGCCGGGG - Intergenic
1121755937 14:96402020-96402042 AGGGCTAAACTCTGGGGCCCAGG - Intronic
1121797908 14:96750959-96750981 AGGCCCCAGCAGTGGGGCAGAGG - Intergenic
1124955865 15:34359941-34359963 AGGTCTCAACATAGAGGCCGGGG + Intronic
1125421366 15:39508003-39508025 AGGGCTCACCTGTGAGGCTGTGG + Intergenic
1127914142 15:63441677-63441699 AGGACACAACAGTGGGGCCTGGG + Intergenic
1128334031 15:66774569-66774591 AGGGCTCCACAGTGGCCCAGGGG - Intronic
1129183892 15:73894150-73894172 ATGGCATAACAGTGGGGCCCTGG - Intergenic
1129255306 15:74330888-74330910 AGGATTCAGCAGAGGGGCCGAGG + Intronic
1129689737 15:77706367-77706389 AGGGTTCAACAGTGCTGCCCTGG - Intronic
1132593090 16:734995-735017 AGGTCCCCACGGTGGGGCCGGGG - Intronic
1132593104 16:735041-735063 AGGTCCCCACAGTGGGGCTGGGG - Intronic
1138399002 16:56730471-56730493 AGGGCACCACAGTGGGGAAGGGG - Intronic
1138658522 16:58504110-58504132 ATGGCTGAGCAGAGGGGCCGGGG - Intronic
1139468523 16:67166461-67166483 AAGGCTTAACAGGGGCGCCGGGG - Intronic
1139961528 16:70720806-70720828 GGAGCTCAAGACTGGGGCCGGGG + Intronic
1140759724 16:78099889-78099911 AGGGGGCCGCAGTGGGGCCGCGG + Intronic
1143262102 17:5607115-5607137 AGGGCTTAAAGATGGGGCCGTGG + Intronic
1144100434 17:11937821-11937843 AGGGCTGAACAGTGGTGGCTTGG + Intronic
1154422927 18:14250976-14250998 AGGCCTCATCAGTGGGGACCTGG + Intergenic
1157491605 18:48127616-48127638 AGGGGAGAACAGTGGGGCCCTGG - Intronic
1158210564 18:55044832-55044854 GGGGCCTATCAGTGGGGCCGGGG + Intergenic
1161964822 19:7542017-7542039 GCGGCTCAGCAGAGGGGCCGAGG - Exonic
1164540799 19:29120248-29120270 AGGGCTCAAGAGTCCGGCTGGGG - Intergenic
1165493937 19:36141101-36141123 AGGCCTGATCAGCGGGGCCGGGG + Exonic
1167209677 19:48126080-48126102 AGGGCTAAACAGTGGGATAGGGG - Intronic
1167654424 19:50754187-50754209 AGCTCTCACCAGTGGTGCCGGGG + Intergenic
1202639644 1_KI270706v1_random:70157-70179 AGGCCTCATCAGTGGGGACCTGG - Intergenic
931428954 2:62195212-62195234 AGGGCGCATCGGTGGGCCCGGGG + Intergenic
933157823 2:78993858-78993880 AGGGCGCTACAGTGGGGGCCGGG - Intergenic
934495121 2:94789596-94789618 AGGCCTCATCAGTGGGGACCTGG - Intergenic
934973945 2:98787179-98787201 AGGGCTCAGGGGTGGGGCTGGGG + Intergenic
946365683 2:219247623-219247645 AGAGCTCAAAAGTGGGGCACAGG - Intronic
948014021 2:234673094-234673116 AGAGCTCAACAGTGGTCCCCAGG + Intergenic
948156889 2:235790707-235790729 ATGAGTCAACAGTGGGGCTGGGG - Intronic
1170180732 20:13527095-13527117 AAGGCTCAACCCTGGGGCTGTGG + Intronic
1170761394 20:19254333-19254355 AGAGCTCATCTGTGGGGACGCGG + Intronic
1171091994 20:22294088-22294110 AAGGGTCGAGAGTGGGGCCGGGG + Intergenic
1171886311 20:30654512-30654534 AGGCCTCATCAGTGGGGACCTGG - Intergenic
1172386478 20:34537503-34537525 TGGGGTCAGCAGTGGGGACGGGG + Intronic
1172630604 20:36375826-36375848 AGGCCTCAACTGTTGGGCTGGGG + Intronic
1175252201 20:57616510-57616532 TGGGCTCAACTGTGGGGACCTGG - Intronic
1175782417 20:61690946-61690968 AGGGCTCAGCCCTGGGGCGGGGG - Intronic
1175939116 20:62529774-62529796 CGGGAGCAGCAGTGGGGCCGTGG - Intergenic
1176015851 20:62931720-62931742 AAGGCCCAAGAATGGGGCCGGGG - Intronic
1176647971 21:9367756-9367778 AGGCCTCATCAGTGGGGACCTGG - Intergenic
1179324413 21:40326281-40326303 ATGGCTCAACAGTGGGACATGGG + Intronic
1180362298 22:11911713-11911735 AGGCCTCATCAGTGGGGACCTGG + Intergenic
1180825257 22:18856997-18857019 AGGGCTAAACACTGGTGCCCAGG - Intronic
1180981226 22:19878927-19878949 AGGGCTCGACAGCGTGTCCGGGG + Intronic
1181187472 22:21117550-21117572 AGGGCTAAACACTGGTGCCCAGG + Intergenic
1181211726 22:21292943-21292965 AGGGCTAAACACTGGTGCCCAGG - Intergenic
1181397782 22:22633943-22633965 AGGGCTAAACACTGGTGCCCAGG + Intergenic
1181534511 22:23534561-23534583 AGGGCAGACCAGTGGGGGCGGGG - Intergenic
1181651629 22:24262115-24262137 AGGGCTAAACACTGGTGCCCAGG - Intergenic
1181944670 22:26506867-26506889 AGGGCTCAAGAAAGGGGCAGCGG - Exonic
1182445522 22:30387330-30387352 CTGGCCCAACAGTGGGGCCAGGG + Exonic
1182476776 22:30580826-30580848 AGAGCTCAGGAGTGGGGCCTTGG - Intronic
1184437244 22:44486665-44486687 AGGGCTCTGCTGTGGGCCCGGGG - Intergenic
1184464458 22:44660640-44660662 AGGGCTCAGGGGTGAGGCCGAGG + Intergenic
1184847883 22:47100267-47100289 AGGGCACAAGAGTGAGGCTGTGG + Intronic
1185281046 22:49970043-49970065 TGGGCTCCCCAGTGGGGCCTGGG + Intergenic
1203215227 22_KI270731v1_random:2489-2511 AGGGCTAAACACTGGTGCCCAGG + Intergenic
1203275406 22_KI270734v1_random:82900-82922 AGGGCTAAACACTGGTGCCCAGG - Intergenic
952361015 3:32629987-32630009 AAGGCTCAACAGTAGGGCTCAGG + Intergenic
952967072 3:38628068-38628090 AAGGCTCAACAGTGTTGCTGAGG + Intronic
954421299 3:50420388-50420410 GGGGCTCAGCAGTGGTGCTGTGG + Intronic
956797228 3:72728046-72728068 AGGGCTCTCCAGTGGGACTGTGG + Intergenic
960986921 3:123286789-123286811 AGGGCTCAACATCGGCCCCGTGG - Exonic
961102055 3:124207936-124207958 AGTGATCACCAGTGGGGCAGGGG + Intronic
961659001 3:128458478-128458500 AGAGCTCAGCAGAGGGGCAGGGG - Intergenic
961780443 3:129317394-129317416 AGGGCACAGGAGTGGGGCTGGGG + Intergenic
1202738914 3_GL000221v1_random:37231-37253 AGGCCTCATCAGTGGGGACCTGG + Intergenic
969106015 4:4807630-4807652 AGGGCTCAACAGCATGGCAGAGG + Intergenic
970326990 4:14936233-14936255 GGGGCTCAGCAGTGGGGCAAAGG + Intergenic
973369893 4:49236510-49236532 AGGCCTCATCAGTGGGGACCTGG - Intergenic
973391139 4:49558902-49558924 AGGCCTCATCAGTGGGGACCTGG + Intergenic
976755797 4:88496888-88496910 AGGGCTCCACACTGGGGATGAGG - Intronic
977324747 4:95561071-95561093 AGAGCTTCACAGTGGGGGCGAGG - Intergenic
986671977 5:10150667-10150689 AGGGCTCAACAATCGGGTAGTGG + Intergenic
989069824 5:37498411-37498433 AGGGCTCAACACTGAGCCCTGGG - Intronic
997598146 5:135120866-135120888 AGAGCTCAGCTGTGGGGCCCAGG - Intronic
997606427 5:135178500-135178522 AGGGCTCAAGAGTGCTGCTGGGG - Intronic
1001296700 5:170503931-170503953 AGGGCTGCACGGTGGGGGCGGGG - Intronic
1001580059 5:172792096-172792118 AGGGACCAACTGTGGGGCCTTGG + Intergenic
1002212190 5:177605645-177605667 AGGGCCCAACTGTGGGGTGGGGG - Intronic
1006384913 6:33725339-33725361 AGGGCTCTGCAGGGGGGCAGTGG + Intronic
1006665196 6:35688592-35688614 GGGGCGCCGCAGTGGGGCCGAGG + Intronic
1006830486 6:36965014-36965036 AGGAGTCACCAGTGGGGCCTAGG + Intergenic
1008494422 6:52118245-52118267 AGTGGTCAACAGTGGAGCCCTGG - Intergenic
1019152613 6:170018968-170018990 AGGGATGGACAGTGGGGCCGAGG + Intergenic
1023849510 7:44142210-44142232 AGGGCACAGCAGAGGGGCTGGGG + Intergenic
1028463736 7:91125243-91125265 AGGGCTAGACACTGGGGCCTGGG + Intronic
1029551717 7:101240112-101240134 GGGGCTGAACAAAGGGGCCGAGG + Intronic
1032076795 7:128839892-128839914 AGGGCTCCAGAGCAGGGCCGTGG + Intronic
1032263566 7:130355083-130355105 GGGGCCCAACAGAGGGGCCTGGG - Intronic
1032383461 7:131506087-131506109 GGGGCTCTACAGTGAAGCCGGGG - Intronic
1035391224 7:158506330-158506352 CGGGCTCCACAGTGAGGCTGAGG + Intronic
1036755555 8:11468600-11468622 AGGGCTCAGCACCGGGGCTGTGG - Intronic
1036770891 8:11577754-11577776 AGGGCCCAGCAGTGGAGCTGGGG + Intergenic
1038671871 8:29589386-29589408 AGGGCTCAGCTGTGGGGCATGGG + Intergenic
1039434904 8:37553372-37553394 AGGTCTCAGCAGTGGGGCCTTGG - Intergenic
1046871441 8:119208862-119208884 AGGGCCGAACATTGGGGACGTGG + Intronic
1048878652 8:138856021-138856043 AGAGCTGGACAGTGGGGCTGGGG + Intronic
1049158008 8:141078665-141078687 CGGGCTCAACCCTGGGGCCGTGG - Intergenic
1049203609 8:141353267-141353289 AGGGCTCCACAGGGAGGCAGCGG - Intergenic
1049606801 8:143533296-143533318 AGGGCTCAGCTCTGAGGCCGAGG - Intronic
1053912449 9:42920926-42920948 AGGCCTCATCAGTGGGGACCTGG + Intergenic
1058927755 9:109684348-109684370 AGGGGTCTAGAGTGGGGCCCGGG - Intronic
1059467556 9:114478617-114478639 AGGGCACCACCGTGGGGCTGGGG + Exonic
1060665137 9:125428241-125428263 AGTGCTCAGAGGTGGGGCCGCGG + Intergenic
1061960070 9:133983398-133983420 AGGGCTCAACAGAGGCACAGGGG + Intronic
1203790472 EBV:148890-148912 AGGGCTCACCAGGGAGGCCTGGG - Intergenic
1203707642 Un_KI270742v1:67675-67697 AGGCCTCATCAGTGGGGACCTGG + Intergenic
1203547752 Un_KI270743v1:140889-140911 AGGCCTCATCAGTGGGGACCTGG - Intergenic
1187862307 X:23694243-23694265 AGGGGTCAAATGTGGGGCCAAGG + Intergenic
1189198170 X:39168964-39168986 AGGGCTCAGGAGAGGGGCAGGGG + Intergenic
1190732020 X:53232825-53232847 TGGGCTCCACAGTGGGGAAGGGG + Intergenic
1192554200 X:72077248-72077270 AGTGTTCAACAGTGGGGAGGTGG - Intergenic
1193383732 X:80846495-80846517 AGGGCTCTGCAGTGAGGCCACGG - Intergenic
1195079293 X:101355889-101355911 TGGGCTCAGCACTGGGGCAGAGG + Intronic
1195884594 X:109625323-109625345 AGGGGACAAGAGTGGGGGCGAGG + Intronic
1198442339 X:136675327-136675349 AGAGCTCTACACTGGGACCGGGG + Intronic