ID: 1084519662

View in Genome Browser
Species Human (GRCh38)
Location 11:69655582-69655604
Sequence GAGTCCTATATTGAGTGGGT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 62
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 57}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1084519656_1084519662 -4 Left 1084519656 11:69655563-69655585 CCGGGAGCCTTCCTCGAGGGAGT 0: 1
1: 0
2: 2
3: 17
4: 142
Right 1084519662 11:69655582-69655604 GAGTCCTATATTGAGTGGGTGGG 0: 1
1: 0
2: 0
3: 4
4: 57
1084519652_1084519662 13 Left 1084519652 11:69655546-69655568 CCCTGAGGGTGGGGGCTCCGGGA 0: 1
1: 1
2: 0
3: 29
4: 293
Right 1084519662 11:69655582-69655604 GAGTCCTATATTGAGTGGGTGGG 0: 1
1: 0
2: 0
3: 4
4: 57
1084519650_1084519662 14 Left 1084519650 11:69655545-69655567 CCCCTGAGGGTGGGGGCTCCGGG 0: 1
1: 0
2: 0
3: 37
4: 354
Right 1084519662 11:69655582-69655604 GAGTCCTATATTGAGTGGGTGGG 0: 1
1: 0
2: 0
3: 4
4: 57
1084519653_1084519662 12 Left 1084519653 11:69655547-69655569 CCTGAGGGTGGGGGCTCCGGGAG 0: 1
1: 0
2: 2
3: 35
4: 438
Right 1084519662 11:69655582-69655604 GAGTCCTATATTGAGTGGGTGGG 0: 1
1: 0
2: 0
3: 4
4: 57
1084519642_1084519662 26 Left 1084519642 11:69655533-69655555 CCACCAGCCTCTCCCCTGAGGGT 0: 1
1: 0
2: 2
3: 50
4: 413
Right 1084519662 11:69655582-69655604 GAGTCCTATATTGAGTGGGTGGG 0: 1
1: 0
2: 0
3: 4
4: 57
1084519648_1084519662 19 Left 1084519648 11:69655540-69655562 CCTCTCCCCTGAGGGTGGGGGCT 0: 1
1: 0
2: 7
3: 32
4: 368
Right 1084519662 11:69655582-69655604 GAGTCCTATATTGAGTGGGTGGG 0: 1
1: 0
2: 0
3: 4
4: 57
1084519644_1084519662 23 Left 1084519644 11:69655536-69655558 CCAGCCTCTCCCCTGAGGGTGGG 0: 1
1: 2
2: 3
3: 65
4: 371
Right 1084519662 11:69655582-69655604 GAGTCCTATATTGAGTGGGTGGG 0: 1
1: 0
2: 0
3: 4
4: 57

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1084519662 Original CRISPR GAGTCCTATATTGAGTGGGT GGG Intronic
913440020 1:118887270-118887292 GAGTCCCAAAATGAGTGGGTAGG - Intronic
919654212 1:200181540-200181562 GACTCCTACATGGAGTGGCTGGG + Intergenic
1064091705 10:12390978-12391000 GAGTCCAGCATTGAGTGAGTAGG + Intronic
1077687138 11:4304274-4304296 AAGTCATAGATTGATTGGGTTGG + Intergenic
1080765129 11:35288933-35288955 AAGTCCTAGTTTGATTGGGTGGG - Intronic
1081682712 11:45019465-45019487 GAGTCCTCTGTTGGGTGGGATGG - Intergenic
1084519662 11:69655582-69655604 GAGTCCTATATTGAGTGGGTGGG + Intronic
1084567889 11:69942044-69942066 GGCTCCTGTGTTGAGTGGGTGGG - Intergenic
1087064277 11:94012463-94012485 GAAGCCTGTATTGAGTGTGTAGG + Intergenic
1093330399 12:17829922-17829944 TTGTCCTATATAGTGTGGGTAGG + Intergenic
1095484800 12:42673795-42673817 GAGACATGTATTGAGTGGATGGG + Intergenic
1100611101 12:96193164-96193186 GAGTCCCAGATTCAGTAGGTCGG - Intergenic
1107274015 13:38656579-38656601 GAGTTTTATATTGAAGGGGTTGG - Intergenic
1112201205 13:97277158-97277180 GAGTCATATACTGAGTTGGGTGG + Intronic
1112856589 13:103777772-103777794 GTGTCTTATAATGAATGGGTGGG - Intergenic
1113296900 13:108969074-108969096 GACTCCCATTTTGAGTGAGTTGG + Intronic
1122676335 14:103417344-103417366 GAGTACTAGATTGAGTGAGCAGG + Intronic
1131128254 15:89874898-89874920 GAGTCGTATTTTAAGTTGGTGGG + Intronic
1132384571 15:101390909-101390931 GAGTCCTGTGGTGGGTGGGTGGG - Intronic
1134147796 16:11781109-11781131 AAGTCCTATATAGAAGGGGTTGG + Intronic
1141625988 16:85261305-85261327 GAGTCATACACTGAGTGAGTGGG - Intergenic
1142223819 16:88867823-88867845 GAGTCCTTCACAGAGTGGGTGGG - Intergenic
1146959786 17:36964286-36964308 GTGTCCTATAGTGGGTGAGTGGG + Intronic
1148354747 17:46968380-46968402 GAGTCACACATTCAGTGGGTTGG - Intronic
1150161839 17:62905045-62905067 GAGACCTCTTTTGGGTGGGTGGG + Intergenic
1154042359 18:10868962-10868984 GATTCTTTTACTGAGTGGGTTGG + Intronic
1159450161 18:68590584-68590606 GAGTCCTTAAATGAATGGGTGGG - Intergenic
1162721827 19:12667139-12667161 GAGTCCTATACTGTGGGGATTGG + Intronic
1165370138 19:35400211-35400233 GAGTTTTATACTGAATGGGTTGG - Intergenic
1167722780 19:51190184-51190206 GAGTTCTATGTTGGATGGGTTGG + Intergenic
937646170 2:124268666-124268688 GAGTCAGATATTGAATGGGCAGG - Intronic
940762217 2:157750571-157750593 GTCTCCTATATTGGGTTGGTAGG - Intronic
943968753 2:194374987-194375009 GAGGCCTATATTCAGTGAGGAGG + Intergenic
946120821 2:217512476-217512498 GATGCAAATATTGAGTGGGTAGG + Intronic
947819688 2:233061225-233061247 GAGACCCAAATTGAGGGGGTGGG - Intronic
1170854956 20:20043937-20043959 GAGTCCCAGTTTGAGTGGGGAGG - Intronic
1177327433 21:19609708-19609730 GACTCCTTGATTGAGTAGGTAGG - Intergenic
1184187440 22:42874156-42874178 GATTCCTATAGTGGGTGGGGTGG + Intronic
949797197 3:7864111-7864133 GAATCCTATATTGAGAGGTGTGG - Intergenic
951526827 3:23661356-23661378 AAGTCATATAGTGAGTGGGTAGG + Intergenic
954822741 3:53345686-53345708 TAGTCATATATTGAATGTGTTGG + Intronic
959648475 3:108728692-108728714 TAGTCCCTTATTGACTGGGTTGG + Intergenic
969969698 4:11032910-11032932 GAGTCCTAGAATGAGTAGATAGG + Intergenic
971316003 4:25568729-25568751 GAGTACAATATTGATTGGGATGG - Intergenic
972440098 4:39079703-39079725 GAGTCTTACATTTAGAGGGTAGG - Intronic
974241693 4:59257507-59257529 GAGTCCTAAATTGAGTTTATGGG - Intergenic
975668740 4:76758823-76758845 GAGTCATTTATTCAGTGGGTAGG + Intronic
976467537 4:85387852-85387874 GACTATTATATTGAGTGGGCAGG + Intergenic
981969543 4:150650607-150650629 AAGTCCTAGCATGAGTGGGTTGG - Intronic
982016254 4:151156647-151156669 GAGTCTTATAAAGAGTGAGTGGG - Intronic
986211366 5:5676181-5676203 GAGTTCTTTATTGGGTGGGTGGG + Intergenic
998856634 5:146400590-146400612 GAAACCTATAGTGAGGGGGTGGG - Intergenic
1008573382 6:52836164-52836186 AAGTCCTTCTTTGAGTGGGTGGG - Intronic
1012338615 6:98090796-98090818 TGCTCCTATATTGTGTGGGTGGG - Intergenic
1032245411 7:130207019-130207041 GAGTCACATATGGAGGGGGTGGG - Intronic
1043919641 8:85966257-85966279 GAGTAATAAATTCAGTGGGTGGG - Intergenic
1049694902 8:143978329-143978351 GAGGCCTCGCTTGAGTGGGTGGG - Intronic
1062515183 9:136929886-136929908 GAGTCCTACAATGCGTGGCTGGG + Intronic
1186474394 X:9845910-9845932 CAGTCCTATATTTGGGGGGTTGG - Intronic
1186710776 X:12194031-12194053 TAGTCCTCTGTTAAGTGGGTAGG + Intronic
1199506934 X:148573381-148573403 AAGTGCTATATGGAGTGGATAGG + Intronic
1200276729 X:154740601-154740623 GAGTCCTATATACCGTGGGAAGG - Intronic