ID: 1084520889

View in Genome Browser
Species Human (GRCh38)
Location 11:69662107-69662129
Sequence AGACTTGGGCTCTCAAAGCC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 203
Summary {0: 1, 1: 0, 2: 3, 3: 14, 4: 185}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1084520886_1084520889 6 Left 1084520886 11:69662078-69662100 CCTTTTGCGGATACAATTCAATT 0: 1
1: 0
2: 1
3: 14
4: 366
Right 1084520889 11:69662107-69662129 AGACTTGGGCTCTCAAAGCCTGG 0: 1
1: 0
2: 3
3: 14
4: 185
1084520884_1084520889 30 Left 1084520884 11:69662054-69662076 CCAGAAGCTAGGACTTCAACGTT 0: 1
1: 0
2: 3
3: 10
4: 158
Right 1084520889 11:69662107-69662129 AGACTTGGGCTCTCAAAGCCTGG 0: 1
1: 0
2: 3
3: 14
4: 185

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1084520889 Original CRISPR AGACTTGGGCTCTCAAAGCC TGG Intronic
900955116 1:5882047-5882069 AGAATTCGGCCCTCAAGGCCAGG + Intronic
901209711 1:7517915-7517937 AACCCTGGGCTCTCAGAGCCAGG - Intronic
901468901 1:9441808-9441830 AGCATTGGGATCACAAAGCCTGG - Intergenic
902059621 1:13631196-13631218 ACACTTGGTCTCTTAAAGTCAGG + Intergenic
903535517 1:24063830-24063852 AGGCTTCGGGTCTCCAAGCCTGG + Intronic
903778173 1:25806349-25806371 AGACCTGGGCTCTCCAGGCCAGG + Intronic
905887772 1:41500903-41500925 AGACATGGGCAGTCATAGCCTGG + Intergenic
908473024 1:64462934-64462956 AGATTTGGGCTATCTAAGCTTGG + Intergenic
909719872 1:78755048-78755070 AGAAGTGGGCTCCCAAGGCCTGG - Intergenic
911337469 1:96598230-96598252 ATCCTTGGGCTCTCTAACCCAGG - Intergenic
912399811 1:109380726-109380748 CGCCTTGGCCTCCCAAAGCCTGG - Intronic
912664251 1:111564806-111564828 AGAGTTGGGGTCTCACAGGCCGG - Intronic
916054149 1:161056317-161056339 ACACTTGGGATGTCAAAACCAGG + Intronic
917519355 1:175735219-175735241 AGACATGGGCTCTCCAGCCCTGG + Intronic
919006716 1:191908627-191908649 AGAGGTGGGCTCCCAAGGCCTGG + Intergenic
919634010 1:199986616-199986638 TGAGTTGGAGTCTCAAAGCCTGG - Intergenic
920970497 1:210739467-210739489 AGATATGGCCTCTCAAAGGCAGG - Intronic
922239822 1:223748317-223748339 AGATTTTGGCTCCAAAAGCCAGG - Intronic
923469524 1:234278240-234278262 AGCCTTGGCCTCTCAAAGTGCGG - Intronic
924673673 1:246153718-246153740 TGCCTTGGCCTCCCAAAGCCTGG + Intronic
924696376 1:246404687-246404709 AGACTTGTGCTCTCCAATACTGG + Intronic
1063163821 10:3441932-3441954 TGCCTTGGCCTCTCAAAGACAGG + Intergenic
1063403030 10:5766240-5766262 AGACTTGGGAACAGAAAGCCAGG - Exonic
1064374823 10:14785954-14785976 TGCCTTGGCCTCTCAAAGACTGG + Intergenic
1064686564 10:17867786-17867808 AAACTTGGGCTCTAAGAGCATGG - Intronic
1065219454 10:23481243-23481265 AGCCTTGGCCTCTCAAAGTATGG - Intergenic
1068474508 10:57507725-57507747 ACATATGGGCTCCCAAAGCCAGG + Intergenic
1069802898 10:71093334-71093356 AGCCCTGGGCTCTCAGAGCCAGG - Intergenic
1071709069 10:88031034-88031056 AGCTTTGGGCTCTAAAACCCAGG + Intergenic
1072268988 10:93757144-93757166 AGACCTGCGTTCTCAAAGCCAGG + Intergenic
1072273100 10:93796456-93796478 AGAGTTGGGGATTCAAAGCCAGG - Intronic
1073179539 10:101575352-101575374 AGACTTGGGCTCCCCAAACAGGG - Intronic
1073312130 10:102550548-102550570 AGCCATGGTCTCTCAAAGCATGG + Intronic
1073792571 10:106955174-106955196 AGACCTCGGCTCCCCAAGCCAGG + Intronic
1075580352 10:123613013-123613035 AAACTTGGGCTTTCAAAGCTTGG + Intergenic
1077008962 11:371603-371625 GGATTTGAGCTCTCAAAGTCTGG - Intronic
1078630636 11:13000659-13000681 AGACATGGCCTCTCAAAGTGAGG - Intergenic
1079472226 11:20789487-20789509 AGACCTGGGCTCCCCGAGCCAGG - Intronic
1081911542 11:46703108-46703130 AGACTTGGGCCCTCAGAGGAAGG - Exonic
1082036721 11:47651084-47651106 CGACTTGGCCTCCCAAAGTCTGG + Intergenic
1082980544 11:59116681-59116703 AGTCAGGGGTTCTCAAAGCCTGG + Intronic
1084520889 11:69662107-69662129 AGACTTGGGCTCTCAAAGCCTGG + Intronic
1084970109 11:72766781-72766803 GGCCTTTGGCTCTCAAGGCCAGG - Intronic
1085030885 11:73270327-73270349 AGAATTTGGCTGTCAGAGCCTGG + Intronic
1086910899 11:92470691-92470713 GGACTTGGGTTTCCAAAGCCAGG - Intronic
1087645798 11:100807094-100807116 TGCCTTGGCCTCTCAAAGTCTGG + Intronic
1089772555 11:120814267-120814289 TGCCTTGGGCTCCCAAGGCCTGG - Intronic
1091674891 12:2482072-2482094 AGAGTTTGGCTCTCAGGGCCTGG - Intronic
1094295667 12:28901710-28901732 AGGGATGGGCTCCCAAAGCCAGG - Intergenic
1094649663 12:32363011-32363033 AGACAGGGTCTCTTAAAGCCTGG - Intronic
1095347550 12:41169327-41169349 AGACTTTCTCTTTCAAAGCCAGG - Intergenic
1098913269 12:76232089-76232111 ATGCTTGGGCCCTCAAACCCAGG - Intergenic
1101288285 12:103339139-103339161 GCATTTGGGCTCTCAAAGGCAGG + Intronic
1102010002 12:109612370-109612392 AGGCTTGGAGTCTCACAGCCTGG - Intergenic
1103512436 12:121484478-121484500 CGACTTGGGCACTCAAGGCCAGG + Intronic
1103517905 12:121519182-121519204 AGACATGGGCCCACAATGCCGGG + Intronic
1107518210 13:41152509-41152531 AGACTTTGCCTCTAACAGCCTGG - Intergenic
1107821922 13:44293707-44293729 AGAGTTGGGCATTCCAAGCCTGG + Intergenic
1110654501 13:77981124-77981146 AGATTTGGAGCCTCAAAGCCTGG + Intergenic
1114896410 14:26996046-26996068 AGTCTTTGGCATTCAAAGCCAGG - Intergenic
1117543438 14:56770762-56770784 AGACATGGGCTCTCCAGGCAAGG + Intergenic
1118434430 14:65756499-65756521 AGACTTGGGCCCAGGAAGCCAGG - Intergenic
1118648747 14:67867678-67867700 AAACTGGGGCTCTCATAGCGAGG + Intronic
1120979642 14:90278744-90278766 TGACCTGGGCTCTCACAGCCAGG + Intronic
1120996554 14:90422378-90422400 ACACATGGGCTCTCAAAGGAAGG - Intergenic
1121005758 14:90489634-90489656 AGAGCTGGGCTCTCAGAGCCTGG + Intergenic
1121484575 14:94304756-94304778 AGACTTGGGCTGTGTAATCCTGG - Intronic
1127090550 15:55462437-55462459 TGCCTTGGCCTCTCAAAGGCTGG + Intronic
1128029931 15:64471111-64471133 AGCCTTGGCCTCTCAAAGTGCGG - Intronic
1128370550 15:67036050-67036072 AGACTTGAGGTCTCCCAGCCTGG - Intergenic
1128440261 15:67700607-67700629 AGCCTTGGGCCATCAAATCCTGG + Intronic
1129326239 15:74801643-74801665 AGACTGGGGCTCCCATAGCAGGG - Intronic
1129888668 15:79056567-79056589 TGACTTGGGCTCTCTGAGTCTGG + Intronic
1132348046 15:101120569-101120591 GGACTTGGCCTCTCTGAGCCAGG + Intergenic
1133465268 16:6021243-6021265 AAACTTGGGCTGTCAAGGCCAGG - Intronic
1135149760 16:19995182-19995204 AGCCATGGGCTCTCACATCCTGG + Intergenic
1137696321 16:50464550-50464572 ACCCTTGGGCTCTCAAGCCCTGG + Intergenic
1138434727 16:56990975-56990997 AGACTGGGGCTCTCAACAACTGG + Intronic
1138586794 16:57975903-57975925 GGCCTTGGGCACTCACAGCCTGG + Intergenic
1140914163 16:79479898-79479920 ACACTTGGGCTGTAAAGGCCTGG - Intergenic
1141610782 16:85180061-85180083 AGCCATGGGCTCACAGAGCCAGG - Intronic
1142057455 16:88007266-88007288 GGACGTGGGCTCTCAGAGGCAGG + Intronic
1142634568 17:1248846-1248868 CGCCTTGGCCTCCCAAAGCCGGG - Intergenic
1145775024 17:27521680-27521702 TGCCTTAGGCTCTCAAAGCGTGG + Intronic
1147612532 17:41810506-41810528 AGTCTTGGGATCTCTAACCCTGG - Intronic
1149869615 17:60169973-60169995 AGAGTTGGGCTCTTAATCCCAGG + Intronic
1150178122 17:63083568-63083590 AGTTTTGAGCTCTCCAAGCCAGG + Intronic
1151357338 17:73567646-73567668 AGGGTTGGGCTCCCAAGGCCTGG - Intronic
1151671495 17:75573884-75573906 GGACCAGGGCTCTCAGAGCCGGG + Intronic
1152860770 17:82696116-82696138 CGCCTTGGCCTCCCAAAGCCGGG + Intronic
1155035119 18:22019587-22019609 ATACTTGGCCTCTCATAGCGTGG - Intergenic
1157261302 18:46177720-46177742 AGAAATGGGCTCTCAAGGCCGGG - Intronic
1157308353 18:46533514-46533536 AGAGTTTGGCTCTGAAAGGCTGG + Intronic
1157680340 18:49600546-49600568 AGACTTGGGCTGGCCAAGCGTGG + Intergenic
1158297972 18:56020203-56020225 AGAGTGGTGCCCTCAAAGCCAGG - Intergenic
1158539545 18:58340386-58340408 AGACTTGGGTGCACATAGCCTGG + Intronic
1158827404 18:61238603-61238625 AGACTTAGGATCTCAGAGCTAGG - Intergenic
1159704782 18:71674012-71674034 AGACCTTGGCTCCCCAAGCCTGG - Intergenic
1162464685 19:10832620-10832642 AAACCTGGGCCCTCCAAGCCAGG - Exonic
1162680592 19:12337857-12337879 AGCCTTGGCCTCTCAAAGGGCGG - Intergenic
1162876535 19:13624822-13624844 AGACTTATGCTCTCAAAACTAGG + Intergenic
1163385102 19:16995100-16995122 AAGCTGGGGCCCTCAAAGCCAGG + Intronic
1165384144 19:35500633-35500655 AAACTGGGGCTCTGAAAGCCCGG - Intronic
1166739616 19:45105944-45105966 AGACTTGGGCACTCTAAGCCAGG - Intronic
1167618334 19:50548336-50548358 AGCACTGTGCTCTCAAAGCCCGG + Intronic
1168191181 19:54739738-54739760 AGACTGGGGTGCTCAAAGCTGGG + Intronic
1168193441 19:54756345-54756367 AGACTGGGGTGCTCAAAGCTGGG + Intronic
925801442 2:7605771-7605793 ATACTTGACCTGTCAAAGCCAGG - Intergenic
925974987 2:9136131-9136153 AAACTTGAGGTCTCATAGCCAGG - Intergenic
928427550 2:31191806-31191828 AGACCTGGGTTTTCAAATCCAGG - Intronic
928559324 2:32462705-32462727 AGCCTTGGCCTCCCAAAGGCTGG - Intronic
928889416 2:36185887-36185909 AGCCTTGTGCTGCCAAAGCCAGG + Intergenic
928978009 2:37108816-37108838 TGCCTTGGCCTCTCAAAGCTGGG + Intronic
930726553 2:54687286-54687308 TGGCTGGGGGTCTCAAAGCCTGG + Intergenic
931260156 2:60610918-60610940 AGACCTGGGTTCTAATAGCCCGG + Intergenic
933655366 2:84882076-84882098 AGACTTGGCTCTTCAAAGCCAGG - Intronic
935175110 2:100642476-100642498 GGACCTGGGCTCCCAAAGCTGGG + Intergenic
939663510 2:144920327-144920349 AGAGATGGGGTTTCAAAGCCAGG + Intergenic
941635677 2:167932571-167932593 ACCCTTGGGATCTGAAAGCCAGG + Intergenic
942635586 2:178001000-178001022 TGACTTGTGCTTGCAAAGCCAGG - Intronic
943797446 2:192014286-192014308 AGCCTAGGGCTCTCAAACTCTGG - Intronic
945267537 2:207905686-207905708 AGTTTGGGGCTCTTAAAGCCAGG + Intronic
945894971 2:215471559-215471581 ACAATTGGGGTCTCACAGCCTGG + Intergenic
947726369 2:232403411-232403433 TGACTTGGACTCCCAAAGACTGG + Intergenic
948315863 2:237027811-237027833 AGACTTGACCTCTCAAAGATGGG + Intergenic
1171067477 20:22032423-22032445 ATACTTCTGCTCTTAAAGCCTGG + Intergenic
1172305470 20:33877202-33877224 AGAGTTGGGGTCTCGCAGCCTGG + Intergenic
1173918865 20:46729030-46729052 ACGCTTGGGCTCCGAAAGCCTGG - Intronic
1175397715 20:58678401-58678423 CGCCTTGGCCTCTCAAAGTCTGG - Exonic
1176962456 21:15174905-15174927 TGCCTTGGCCTCCCAAAGCCAGG - Intergenic
1178219645 21:30641621-30641643 AGACTTAAGTTCTCAAAGGCAGG - Intergenic
1178479407 21:32966725-32966747 TGACTTGGGATTTCAGAGCCAGG + Intergenic
1179251998 21:39678373-39678395 AGACTTAGTCTCTCTAAGACTGG + Intergenic
1181402835 22:22661696-22661718 AGACTGGGGGTCTCAGATCCAGG - Intergenic
1183714526 22:39525945-39525967 TGCCTTGGCCTCCCAAAGCCAGG - Intergenic
1183772132 22:39935972-39935994 TGATTTGGGCTCTGAAAGCATGG - Intronic
1184271566 22:43387415-43387437 GGCCTTGGTCTTTCAAAGCCAGG + Intergenic
950500706 3:13361806-13361828 GGACTTGGGCTCTCTCAACCTGG + Intronic
952497498 3:33928761-33928783 AGTCTTGGGCCCTAAATGCCAGG + Intergenic
953187874 3:40655175-40655197 AGACATGGGCTCTTAACTCCAGG + Intergenic
954326869 3:49868759-49868781 AGTCCTGGGGGCTCAAAGCCTGG + Intronic
954749750 3:52806752-52806774 AGGCTTGGGCTCTGAAGTCCTGG + Intronic
956219783 3:66889948-66889970 ACAGTTGTGCTCTCAAAACCAGG - Intergenic
958675158 3:97260259-97260281 AGCCTTGGGATCATAAAGCCAGG + Intronic
959101636 3:102017075-102017097 AGACTTGTGTTCTAAATGCCTGG + Intergenic
959233587 3:103690207-103690229 AGAGTTGGGCTCCCATGGCCAGG + Intergenic
961724683 3:128919587-128919609 ATTCTTGGACTCTCAAATCCTGG - Intronic
961974186 3:131005364-131005386 AGCCTTGGGCTCCCAAATGCTGG + Intronic
963160721 3:142149032-142149054 AGACCTGGGTTCTCCAGGCCTGG - Intronic
964004602 3:151812397-151812419 AGACTTGTGTTCTCAAAGTTTGG - Intergenic
965232611 3:166072612-166072634 AGGGTTGGGCTCCCAATGCCTGG - Intergenic
966322718 3:178718882-178718904 AGACTTGGGCTTCCAAATCCAGG - Intronic
971299280 4:25428520-25428542 AGACATGGGCCCTCAAAGCCCGG - Intergenic
971642146 4:29147862-29147884 AGCCTTGTGATTTCAAAGCCTGG - Intergenic
976644119 4:87369681-87369703 TGCCTTGGCCTCCCAAAGCCTGG + Intronic
976983487 4:91262199-91262221 AACCTTGGGCTCTCAAACCTTGG + Intronic
977298539 4:95239455-95239477 AGTCTAGGTCTCACAAAGCCAGG + Intronic
978357611 4:107893558-107893580 AGCCTGGGCCTGTCAAAGCCTGG + Intronic
981627811 4:146779712-146779734 AGTCTTTGGCTCTCAACTCCTGG + Intronic
989408671 5:41091738-41091760 AGACTGGGCCTCACAAATCCAGG + Intergenic
994759926 5:103839231-103839253 AGGCATTGTCTCTCAAAGCCTGG + Intergenic
996442396 5:123506785-123506807 AGTCTTAGGCTCTTAAAGCTAGG + Intergenic
996822431 5:127645160-127645182 ATACTTTGGCTCTAACAGCCTGG - Intergenic
998515857 5:142753450-142753472 AGCATTGGGCTTTCTAAGCCTGG + Intergenic
1001582863 5:172811284-172811306 CGCCTTGGCCTCCCAAAGCCTGG - Intergenic
1004763378 6:18696431-18696453 AGCCTTGGCCTCTCAAAGTGTGG + Intergenic
1005964143 6:30714762-30714784 TGCCTTGGCCTCTCAAAGCACGG + Intronic
1008826204 6:55697388-55697410 AGACTTGGGTTCTTAAGACCTGG + Intergenic
1011511813 6:88109431-88109453 AGATGTGGGCTCTGAAGGCCAGG - Intergenic
1012664047 6:101943556-101943578 AGAGGTGGGCTCCCAAGGCCTGG - Intronic
1013126982 6:107193349-107193371 AGACTTGAGCTCTCAAAGGCAGG - Intronic
1013421976 6:109975482-109975504 GGATTTGGGCTCCCAGAGCCAGG + Intergenic
1014433414 6:121395823-121395845 AGAATTGGGCACTGAAATCCTGG - Intergenic
1014505212 6:122247280-122247302 AGACGTGGGGTCCCCAAGCCAGG - Intergenic
1015560781 6:134513093-134513115 AGACTGGGGCTCTGCCAGCCAGG - Intergenic
1024844143 7:53621871-53621893 AGCCTAGGGCTCTCAAATTCTGG + Intergenic
1027252807 7:76409734-76409756 AGGCATGGACTCTCAAGGCCAGG + Intronic
1027977643 7:85179376-85179398 AGAGGTGTGCTCTCAAAGCCTGG - Intronic
1029594938 7:101532677-101532699 AGACTCTGGTTCTCAAAGTCAGG + Intronic
1031521457 7:122771180-122771202 AGCCTTGGGCTGTTAAAGTCTGG + Intronic
1033395533 7:140970558-140970580 TGCCTTGGCCTCTCAAAGGCTGG - Intergenic
1035632174 8:1116356-1116378 AGACTTGGGGTCAGAAAACCTGG + Intergenic
1036547865 8:9789557-9789579 TGCCTTGGCCTCCCAAAGCCTGG - Intergenic
1036970302 8:13347839-13347861 TGCCTTGGACTCACAAAGCCAGG - Intronic
1037920332 8:22801302-22801324 AGACTGGGGCTCACAGAGGCAGG + Intronic
1038543315 8:28406874-28406896 GGAATTGGGGTCTCAATGCCAGG + Intronic
1040888046 8:52286780-52286802 AGTCTTTGGTTCTCAAAGCATGG + Intronic
1042827235 8:72991496-72991518 AGAGGTGGGCTCCCATAGCCTGG - Intergenic
1044860150 8:96515042-96515064 AGACTTGGGTTCTTATAGGCTGG + Intronic
1048817642 8:138348862-138348884 AAACCTGGGCACTCTAAGCCTGG - Intronic
1051986656 9:23096965-23096987 AGAATTGGGCTCCCACAGCTTGG - Intergenic
1052718514 9:32146904-32146926 TGATTTGGGCTCACTAAGCCGGG + Intergenic
1053100784 9:35370628-35370650 TGACTTGGGCTCTCAAAGTTAGG + Intronic
1055416486 9:76089779-76089801 AGACTGATGTTCTCAAAGCCTGG + Intronic
1055528031 9:77155029-77155051 TGCCTTGGCCTCCCAAAGCCTGG - Intergenic
1056222332 9:84462705-84462727 AGCCTTGGCCTCCCAAAGCATGG - Intergenic
1060443918 9:123669941-123669963 AGACTTGAGTTTTCAAAGCCAGG - Intronic
1061380317 9:130252632-130252654 AGATTTGAGCTCCCCAAGCCAGG + Intergenic
1187363021 X:18645446-18645468 AGACGTGGGGTCTGAAAGCAGGG - Intronic
1194151175 X:90326384-90326406 AGGCTTGGACTCTCCAAGGCTGG - Intergenic
1197848644 X:130832742-130832764 AGACCCCTGCTCTCAAAGCCAGG - Intronic
1200497545 Y:3903138-3903160 AGGCTTGGACTCTCCAAGGCTGG - Intergenic
1201312474 Y:12609417-12609439 AACCTTGGCCTCCCAAAGCCTGG - Intergenic