ID: 1084521478

View in Genome Browser
Species Human (GRCh38)
Location 11:69665817-69665839
Sequence CAGGTTTAGAGTTCGGGAGG AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 145
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 136}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1084521469_1084521478 25 Left 1084521469 11:69665769-69665791 CCCAGACCTGAGGTGACGCTACA 0: 1
1: 0
2: 0
3: 1
4: 60
Right 1084521478 11:69665817-69665839 CAGGTTTAGAGTTCGGGAGGAGG 0: 1
1: 0
2: 0
3: 8
4: 136
1084521468_1084521478 26 Left 1084521468 11:69665768-69665790 CCCCAGACCTGAGGTGACGCTAC 0: 1
1: 0
2: 0
3: 3
4: 67
Right 1084521478 11:69665817-69665839 CAGGTTTAGAGTTCGGGAGGAGG 0: 1
1: 0
2: 0
3: 8
4: 136
1084521470_1084521478 24 Left 1084521470 11:69665770-69665792 CCAGACCTGAGGTGACGCTACAA 0: 1
1: 0
2: 0
3: 2
4: 139
Right 1084521478 11:69665817-69665839 CAGGTTTAGAGTTCGGGAGGAGG 0: 1
1: 0
2: 0
3: 8
4: 136
1084521471_1084521478 19 Left 1084521471 11:69665775-69665797 CCTGAGGTGACGCTACAAACGAG 0: 1
1: 0
2: 0
3: 1
4: 20
Right 1084521478 11:69665817-69665839 CAGGTTTAGAGTTCGGGAGGAGG 0: 1
1: 0
2: 0
3: 8
4: 136

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1084521478 Original CRISPR CAGGTTTAGAGTTCGGGAGG AGG Exonic
903646489 1:24899175-24899197 CAGATTCACATTTCGGGAGGGGG - Intergenic
905202656 1:36324339-36324361 CAGGTTTAGCCTTGGGGTGGGGG - Intronic
908354783 1:63318913-63318935 CACGGTTAGAGTGCGGAAGGCGG - Intergenic
912497611 1:110101605-110101627 CCAGTTTAGAGTTCAGGATGGGG + Intergenic
914228665 1:145744324-145744346 CTGGTTTTGAATTGGGGAGGAGG - Exonic
918068659 1:181119064-181119086 CAGGTGTGGAGTTGGGAAGGAGG + Intergenic
918233153 1:182554075-182554097 CAGGGTTAGAGTGTGGGAGTGGG - Intronic
922706198 1:227791653-227791675 CAGGGTTAGGGTTGGGGCGGTGG - Intergenic
1064621113 10:17218309-17218331 GAGGTTTAGAGTTCGGGGACTGG + Intergenic
1069536406 10:69256885-69256907 CAGGGTTAGGGTTGTGGAGGTGG + Intronic
1069950357 10:72014462-72014484 CAGGTTAAGATTTGGGGAGGGGG - Intergenic
1071801511 10:89067810-89067832 CAGATTTGGAGTTAGGCAGGTGG - Intergenic
1071929432 10:90451291-90451313 CATGTTTGGAGTTCTGTAGGGGG - Intergenic
1073503678 10:103966059-103966081 CAGGTTTACAGTTGTGGAGGTGG + Intergenic
1076620242 10:131782643-131782665 CTGATTTAGGGTTCAGGAGGAGG - Intergenic
1077038169 11:505290-505312 CAGGTTTGGAGATTAGGAGGTGG - Intronic
1077582008 11:3422874-3422896 CAGGATAAGAGTCCTGGAGGCGG + Intergenic
1078931509 11:15915550-15915572 CAGCTTTAGAGTTTGGGGGCGGG - Intergenic
1084521478 11:69665817-69665839 CAGGTTTAGAGTTCGGGAGGAGG + Exonic
1085302088 11:75464680-75464702 CAGGTTTAGGCTTGGGGAGGTGG + Intronic
1086257100 11:84890533-84890555 AATGTTTAGGGTTGGGGAGGGGG - Intronic
1086886624 11:92213633-92213655 CAGGTTTACATTTCAGGATGTGG - Intergenic
1089662412 11:119994101-119994123 CTGGGTTTGAGTTGGGGAGGAGG - Intergenic
1090966389 11:131601036-131601058 CAGGTTTGGAGTTTGGGATGGGG + Intronic
1091624752 12:2113392-2113414 CAAGATAAGAGTTGGGGAGGTGG + Intronic
1091760957 12:3086985-3087007 CAGGTTCAGAGTCAGGGAGAGGG + Intronic
1092409613 12:8243323-8243345 CAGGATAAGAGTCCTGGAGGCGG + Intergenic
1094391924 12:29960982-29961004 TAGGTTTAGACTTAGGGTGGTGG - Intergenic
1095397400 12:41776561-41776583 CAGGTTCGGAGTTCAGGTGGAGG - Intergenic
1096530471 12:52239524-52239546 CAGGCTAAGGATTCGGGAGGAGG + Intronic
1101276906 12:103212526-103212548 CAGGTTCAGATTTTGGGGGGAGG + Intergenic
1101504413 12:105332395-105332417 CAGTTTTAGGGATGGGGAGGGGG + Intronic
1101521794 12:105490492-105490514 CAGGTGTAGATTTGGGGAAGTGG + Intergenic
1101640336 12:106582478-106582500 CTGGGTTAGATTTCGGGTGGTGG - Intronic
1110165854 13:72442260-72442282 GAGGTTTTGCGTTCAGGAGGTGG - Intergenic
1114398371 14:22387322-22387344 CAGTTTTAGAGTTGGGAATGCGG + Intergenic
1119388814 14:74276393-74276415 GAGGTCGGGAGTTCGGGAGGTGG - Intergenic
1120930353 14:89841981-89842003 CAGGTTTAGAGAGAAGGAGGAGG - Intronic
1121564288 14:94896899-94896921 CAGGTTGAGGGTTCTGGTGGGGG - Intergenic
1121654206 14:95583454-95583476 CAAGTTGAGATTTGGGGAGGGGG + Intergenic
1126937657 15:53729101-53729123 CAGATTTAGGGTTTGGGAGCTGG - Intronic
1128089774 15:64911735-64911757 CAGGTTAAGAGAGCAGGAGGAGG + Intronic
1128229399 15:66024277-66024299 CAGGTTCAGAATTCTGGAGCTGG - Intronic
1130000429 15:80041780-80041802 CAGATTTGGAGTTAGGCAGGAGG + Intergenic
1130049077 15:80468271-80468293 GAGGTTCAGGGTTGGGGAGGAGG - Intronic
1130372266 15:83295079-83295101 CAGGTTTAGAATTTGGTTGGTGG - Intergenic
1131132215 15:89907619-89907641 CTGGCTTACAGTTCTGGAGGCGG - Intronic
1133350591 16:5098104-5098126 CAGGATAAGAGTCCTGGAGGCGG + Intergenic
1134452684 16:14373181-14373203 CAGGTATGGAGTTGGGGAGCAGG + Intergenic
1135522285 16:23186746-23186768 CAGATTTAGAACTGGGGAGGGGG - Intronic
1135915952 16:26605640-26605662 GTGGTTTACAGTTGGGGAGGGGG + Intergenic
1138077788 16:54059432-54059454 CAGCTTTAGAACTCGTGAGGGGG + Intronic
1138199037 16:55075350-55075372 CAGGGTTAGAGGGCAGGAGGAGG + Intergenic
1138229560 16:55327249-55327271 CAGGAGTACAGTTGGGGAGGGGG - Intronic
1138864210 16:60796488-60796510 CATGTTTAGAGGTCGGGCTGGGG + Intergenic
1139553929 16:67694071-67694093 CAGCCTCAGAGCTCGGGAGGTGG - Intronic
1144541064 17:16143683-16143705 CATGTTTAGAGTTGGGCAGAGGG - Exonic
1147337390 17:39735793-39735815 CAGGTCTGGGGTTGGGGAGGAGG - Intergenic
1150219017 17:63485380-63485402 CAGGTTTGGGGGTGGGGAGGTGG - Intronic
1151322442 17:73360005-73360027 CAGGCTGAGAGGTGGGGAGGTGG - Intronic
1151560804 17:74868616-74868638 CAGACTTAGCGTTCCGGAGGTGG - Intronic
1153022920 18:647477-647499 CAGGTCTAGAGTCTGGGAGGAGG + Intronic
1153437363 18:5081919-5081941 CAGATTTAGATTTGGGGAAGAGG + Intergenic
1156257302 18:35410362-35410384 GAGGTTTAGAGTTCATGGGGTGG + Intergenic
1156578647 18:38349712-38349734 CAGGCTTTGAGTTCTAGAGGAGG - Intergenic
1157070744 18:44404998-44405020 CAGTTTTGGAGTTGGGGATGAGG - Intergenic
1157859859 18:51131920-51131942 CAGATTTAGGGTGAGGGAGGTGG - Intergenic
1160744598 19:704671-704693 GAGGTTTAGAGCTGGGGCGGTGG + Intergenic
1161057746 19:2199178-2199200 CAGGTCTTGAGGTCTGGAGGTGG + Intronic
1165167882 19:33870139-33870161 AAGGTTTGGATTTGGGGAGGAGG + Intergenic
1165880366 19:39038376-39038398 CAGGATTAGAGTGAGGTAGGAGG + Intergenic
927004645 2:18835400-18835422 TAGCTTGAGAGTTTGGGAGGAGG + Intergenic
935413037 2:102786098-102786120 CAGTTTTAGAATTGGGCAGGAGG + Intronic
942327875 2:174790853-174790875 CAGGTATAGAGTGAGGGTGGGGG + Intergenic
945994151 2:216421877-216421899 CAGGGTTTGGGTTCCGGAGGAGG + Intronic
1169664121 20:8015585-8015607 CAGGTTCAGTGTTGGGGAGCTGG - Intronic
1170131178 20:13022076-13022098 TAGTTTTAGAGAGCGGGAGGAGG - Intronic
1172360763 20:34311448-34311470 CAGGTACAAAGGTCGGGAGGAGG - Intronic
1172576494 20:36012957-36012979 GAGGTTTGGAGTTCAGGAGATGG + Intronic
1176057826 20:63158179-63158201 CAGGCTTAGTGTTCAGCAGGTGG + Intergenic
1179990820 21:44947469-44947491 CAGGGCTAGAGTGGGGGAGGAGG - Intronic
1183508029 22:38220199-38220221 CAGGTCTAGAGGTGTGGAGGGGG + Exonic
1185039730 22:48497886-48497908 CAGGTTTGGAGGCCTGGAGGCGG + Intronic
952736632 3:36697698-36697720 CAGGTTTAGGGTCAGGGAGCAGG + Intergenic
953707919 3:45245168-45245190 CAGGTTTGGAGCTTGGGAGGTGG + Intergenic
958554343 3:95655242-95655264 CAGGTTTAGAATTCGTGCAGCGG + Intergenic
958710647 3:97713068-97713090 TAGGCTTAGAGTTAGGGTGGGGG + Intronic
958730876 3:97958951-97958973 AAGGTTTAGAGTTCGTGTGATGG - Intronic
960401053 3:117199372-117199394 GACATTTAGAGTTCCGGAGGAGG - Intergenic
961299801 3:125915633-125915655 CAGGTTTGGGGCCCGGGAGGTGG - Intergenic
961299979 3:125916224-125916246 CAGGATAAGAGTCCTGGAGGCGG - Intergenic
961888521 3:130111850-130111872 CAGGATAAGAGTCCTGGAGGCGG + Intronic
964127626 3:153252279-153252301 CAGATTGAGAGTTCAAGAGGAGG - Intergenic
965887576 3:173466460-173466482 CTGGTGTAGAGTTGGGAAGGAGG + Intronic
966795312 3:183707978-183708000 CTGGTTTAAAGTTGGGGAGGGGG - Intronic
967475098 3:189907431-189907453 ATGGTTTAGAGTTTGGGAGAAGG + Intergenic
968997671 4:3955757-3955779 CAGGATAAGAGTCCTGGAGGCGG + Intergenic
969756339 4:9152895-9152917 CAGGATAAGAGTCCTGGAGGCGG - Intergenic
970702778 4:18762595-18762617 CAAGTTTAGAGGAAGGGAGGAGG + Intergenic
971012889 4:22458664-22458686 CAGGTTTAGAGTTCAGTAAAAGG - Intronic
972876223 4:43364398-43364420 CAGGTTTTTATTTGGGGAGGTGG + Intergenic
973733246 4:53844147-53844169 CTGGTTTAGAGTTCAGGGTGGGG + Intronic
976102835 4:81583649-81583671 CTGCTTTAGAGTCTGGGAGGTGG - Intronic
976324843 4:83759485-83759507 CAGTTTTAGAATTTGGGGGGTGG - Intergenic
984868048 4:184299988-184300010 GAGGTTGGGAGTTCGGGACGAGG - Intergenic
986314538 5:6577741-6577763 CAGGTTTAGAGCTCAAGAGATGG + Intergenic
991996253 5:72390179-72390201 CAGGGTTGGAGTTGGGGAAGTGG - Intergenic
994735353 5:103547251-103547273 CAGATTTTAAGTTGGGGAGGGGG - Intergenic
999038107 5:148376086-148376108 AAGGTTTGGAGTACTGGAGGAGG + Intergenic
1003005364 6:2376231-2376253 GAGGTTTAGAGTTTGTGGGGAGG - Intergenic
1003074233 6:2969991-2970013 CAGGTATGGAGCCCGGGAGGTGG + Intronic
1004360159 6:14963935-14963957 CATTTTTAGAGGTCAGGAGGAGG - Intergenic
1007405988 6:41636833-41636855 GAGGTCTGGGGTTCGGGAGGGGG + Intergenic
1007500772 6:42295124-42295146 CATTGTTAGAGTTAGGGAGGGGG - Intronic
1013130813 6:107230909-107230931 TAGGTTAAGAATTCAGGAGGCGG + Intronic
1014776339 6:125514397-125514419 CAAGTTTAGAGTTTGGGGGAAGG - Intergenic
1015509759 6:134026648-134026670 CAGGTTTAAGGTTCAGGAGCAGG + Intronic
1020622790 7:10537972-10537994 CAGGCTTTGATTTGGGGAGGAGG + Intergenic
1023651899 7:42379578-42379600 CAGGTCAGGAGTTCAGGAGGGGG + Intergenic
1024741350 7:52358257-52358279 AAGATTCAGAGTTTGGGAGGTGG - Intergenic
1028122452 7:87071418-87071440 CACCTTTTGACTTCGGGAGGTGG - Intergenic
1031035506 7:116784081-116784103 CAGGTTTGGAGTTGGGCAGCTGG + Intronic
1032459206 7:132097050-132097072 CAGGTTCAGAGTTCCTGATGTGG - Intergenic
1036198436 8:6744700-6744722 CAGGTTTAGAGCGAGTGAGGAGG - Intronic
1036379580 8:8228203-8228225 CAGGATAAGAGTCCTGGAGGCGG - Intergenic
1036598266 8:10234347-10234369 CGGGTTTTGAGTTTGGGAGAAGG + Intronic
1036849982 8:12194412-12194434 CAGGATAAGAGTCCTGGAGGCGG + Intergenic
1036850171 8:12195000-12195022 CAGGTTTGGGGCCCGGGAGGCGG + Intergenic
1036871344 8:12436685-12436707 CAGGATAAGAGTCCTGGAGGCGG + Intergenic
1036871534 8:12437273-12437295 CAGGTTTGGGGCCCGGGAGGCGG + Intergenic
1041872949 8:62655752-62655774 CAGGTTTGGAATTCAGGAAGGGG + Intronic
1049580836 8:143409851-143409873 CAGGTCCAGAGTGCGGCAGGAGG - Intergenic
1051828696 9:21251530-21251552 CAGCTTTAGAATTTGGAAGGAGG - Intergenic
1055486857 9:76764616-76764638 AAGGTTTAAAGTTGGGGAAGAGG + Intronic
1055877566 9:80961739-80961761 CAGGGTTTCAGTTCGTGAGGTGG + Intergenic
1057196154 9:93116453-93116475 CAGGTTCAGAATCTGGGAGGGGG + Intergenic
1059057975 9:111004478-111004500 AAGGTTTTGAGTTGGGGTGGAGG - Intronic
1059096420 9:111420477-111420499 CAGTTTGAGAGTTGGGGTGGCGG - Intronic
1059388036 9:113980365-113980387 CAGGTCTGGAGTTCGGTGGGGGG + Intronic
1061075763 9:128340615-128340637 CAGGTTTGGGGTGCGGGAGGCGG + Intergenic
1062486442 9:136778801-136778823 CAGTTTGAGAGTTGGGGAGCTGG - Intergenic
1186405918 X:9302699-9302721 CAGCTTCAGAGTTCTGGGGGTGG - Intergenic
1188902569 X:35752195-35752217 CAGAATTAGAGTTCGGCATGAGG + Intergenic
1191899925 X:66030498-66030520 GATGTTAAGAGTTCAGGAGGAGG + Intronic
1194939788 X:99995781-99995803 CAGCTATAGAGTAAGGGAGGGGG + Intergenic