ID: 1084522768

View in Genome Browser
Species Human (GRCh38)
Location 11:69674759-69674781
Sequence CAGGGGCTCTGGAGGGAAAA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 639
Summary {0: 1, 1: 0, 2: 4, 3: 60, 4: 574}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1084522752_1084522768 6 Left 1084522752 11:69674730-69674752 CCCCCACTGTCGCAGCACGAGGG 0: 1
1: 0
2: 0
3: 10
4: 71
Right 1084522768 11:69674759-69674781 CAGGGGCTCTGGAGGGAAAAGGG 0: 1
1: 0
2: 4
3: 60
4: 574
1084522754_1084522768 5 Left 1084522754 11:69674731-69674753 CCCCACTGTCGCAGCACGAGGGG 0: 1
1: 0
2: 0
3: 5
4: 80
Right 1084522768 11:69674759-69674781 CAGGGGCTCTGGAGGGAAAAGGG 0: 1
1: 0
2: 4
3: 60
4: 574
1084522750_1084522768 26 Left 1084522750 11:69674710-69674732 CCAGGAGGCAACTCACAGCTCCC 0: 1
1: 0
2: 3
3: 19
4: 229
Right 1084522768 11:69674759-69674781 CAGGGGCTCTGGAGGGAAAAGGG 0: 1
1: 0
2: 4
3: 60
4: 574
1084522757_1084522768 3 Left 1084522757 11:69674733-69674755 CCACTGTCGCAGCACGAGGGGCT 0: 1
1: 1
2: 0
3: 4
4: 73
Right 1084522768 11:69674759-69674781 CAGGGGCTCTGGAGGGAAAAGGG 0: 1
1: 0
2: 4
3: 60
4: 574
1084522756_1084522768 4 Left 1084522756 11:69674732-69674754 CCCACTGTCGCAGCACGAGGGGC 0: 1
1: 0
2: 0
3: 8
4: 49
Right 1084522768 11:69674759-69674781 CAGGGGCTCTGGAGGGAAAAGGG 0: 1
1: 0
2: 4
3: 60
4: 574

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1084522768 Original CRISPR CAGGGGCTCTGGAGGGAAAA GGG Intronic
900619552 1:3580549-3580571 CAGGGGCTCTGGAGAGAGAGGGG + Intronic
900740925 1:4330279-4330301 CTGGGTCTAGGGAGGGAAAAAGG + Intergenic
900932524 1:5746152-5746174 CAGGCGCTCAGAAGGGAAGAGGG + Intergenic
901224962 1:7608028-7608050 CAGGGGCTCAGGAGGAACTATGG - Intronic
901445801 1:9307399-9307421 CAGGGGCTGGGGAGGGAGGATGG - Intronic
901760000 1:11464585-11464607 TAGGAGCTCAGGAGGGTAAATGG - Intergenic
901857061 1:12051351-12051373 CTGGGGGCCTGGAGGCAAAATGG + Intergenic
902099364 1:13973278-13973300 CAGTGGATCTAGAGGGGAAAGGG - Intergenic
902211487 1:14907864-14907886 CATGGGCTCTGGGGAGAGAAGGG - Intronic
902245448 1:15117728-15117750 CATGGGCTCTGATGGGAAGAGGG - Exonic
902396401 1:16134417-16134439 CATGGGCTTGGGTGGGAAAATGG - Intronic
902538633 1:17136621-17136643 CAAGGGATCTGGAGGGGAAGGGG + Intergenic
902728145 1:18350896-18350918 TAGGGGCTCTGCAGGGAGATCGG + Intronic
903684353 1:25120090-25120112 AGGGGGCTCAGGAGGGAAGAAGG - Intergenic
903887794 1:26551115-26551137 GATGGGGTCTGGTGGGAAAAGGG + Intronic
904128883 1:28260739-28260761 CAGGGGCTTTGCAGGGAGACCGG + Intronic
904478294 1:30778206-30778228 CACGGGTGCTGGAGGGAACAGGG + Intergenic
904616955 1:31755141-31755163 CAGGAGACCTGGAGGGAACAGGG - Intronic
905182306 1:36175025-36175047 AAGGGGCTCTGGAGGGGGAAGGG - Intronic
905325811 1:37151290-37151312 CAGGGGCCCTGGAGGCTTAAGGG - Intergenic
905514956 1:38555839-38555861 CAGGGTTACTGGAGGGAAAGGGG + Intergenic
905696793 1:39980614-39980636 CAGCTGCCCTGGAGGGAAAAAGG - Intergenic
907734235 1:57096210-57096232 CACCGGCTCTGGAGTGAGAAAGG - Intronic
907757973 1:57329278-57329300 CATGGGCTTTGGAGGGAGGAAGG - Intronic
907936484 1:59046640-59046662 CAGGGTCTCTGCAGGGATCAGGG + Intergenic
910040885 1:82850463-82850485 GAGGGGAGCTGGAGGGCAAATGG + Intergenic
911582287 1:99647859-99647881 AAGGTACACTGGAGGGAAAAAGG - Intronic
912850327 1:113118611-113118633 CATGGGCTCTGGAGCCAGAATGG + Intronic
913076056 1:115341376-115341398 CAAGGGCTCAGGAAGGACAAAGG + Intergenic
913372971 1:118121145-118121167 GAAAGGCTCTGAAGGGAAAATGG + Intronic
915615425 1:157034138-157034160 CTGGGGCTCTGAAGGGAAGAGGG + Intronic
916186898 1:162142237-162142259 CAGTGGCTCTGTAAGGAAGATGG + Intronic
916640074 1:166718030-166718052 CATTGCCTCTGGAGGGAAAGTGG + Intergenic
916679383 1:167090212-167090234 CCTGGGCACTGGAGAGAAAAGGG + Intronic
916885464 1:169063588-169063610 CAGGAGGTATGGTGGGAAAAAGG - Intergenic
916997443 1:170316003-170316025 AAGGAGCTCTGGAAGGAAGAGGG - Intergenic
917133457 1:171765011-171765033 CAGAGGCTGAGGAGGGGAAAGGG + Intergenic
917981172 1:180270416-180270438 CAGGGGCACTGTGGAGAAAAGGG + Intronic
919697208 1:200589841-200589863 CAGGGGCAATGTAGGGAAACCGG - Intronic
919823680 1:201488977-201488999 CAGGGGCTCTGCATGGAGAAGGG + Exonic
920074758 1:203327847-203327869 GAGGGACTCTGGAGGGAGGACGG - Intergenic
920847541 1:209606657-209606679 CAGGGACTCTGGAGGGCTCAGGG - Intronic
920983615 1:210862902-210862924 CAGGGAATCTGTAGGGAAGAAGG - Intronic
921286888 1:213616889-213616911 CATGGGTTCTGGAGGCACAAAGG + Intergenic
921734090 1:218606968-218606990 CAGGGGCTAAGCAGGGGAAAGGG + Intergenic
921764105 1:218950448-218950470 AAGGGGGTCTTAAGGGAAAAAGG - Intergenic
922523760 1:226281260-226281282 CAGAGGCTGGGAAGGGAAAAGGG + Intronic
922671317 1:227510362-227510384 CAGGGGCCCAGGAGGGAGCAGGG + Intergenic
922755289 1:228093219-228093241 CAGGGACTCTGGTGGAAGAAAGG + Intronic
922784904 1:228277965-228277987 CAGGGACTCAGGAGGGAAGGGGG + Intronic
924052505 1:240092609-240092631 CAGGGGCGCAGGATGGACAAAGG + Exonic
924226480 1:241926393-241926415 GTGGGGATGTGGAGGGAAAAAGG - Intergenic
924335698 1:242985164-242985186 AATGGGCTCTGGAGGGGAGACGG - Intergenic
1062763457 10:44925-44947 CAGGGGCCCAGGAGGGAACAGGG - Intergenic
1063103255 10:2969990-2970012 CAGTGGCTCTTGAGGAAAACAGG + Intergenic
1063202848 10:3801598-3801620 CAAGGGCTCTGGGGGAAAGATGG + Intergenic
1063297839 10:4825404-4825426 CAGGGCCAGTGGAGGGAAAGAGG - Intronic
1063455776 10:6181899-6181921 CAGGGGCTGGGGAGGGAGAATGG + Intronic
1063565657 10:7170773-7170795 CAGGGGCCTTGGAGGGAGAAGGG + Intronic
1063613254 10:7580923-7580945 AAGGGCCTCTGAAGGAAAAAGGG - Intronic
1063615895 10:7600322-7600344 CAGGGGACCAGGTGGGAAAATGG - Intronic
1064164652 10:12975596-12975618 CAGGGACTCTGGACAGAAAGTGG + Intronic
1065589065 10:27247632-27247654 CAGAGGATCAGGAGGGAACAGGG - Intergenic
1065778387 10:29143593-29143615 CAGGGGATCTGGAAGGAGAATGG - Intergenic
1065945133 10:30599307-30599329 CAGGGGCTATGAAGGGACAAAGG - Intergenic
1067109914 10:43392967-43392989 CAGAGGCTCTAGAAGGAAACTGG + Intronic
1067246607 10:44552509-44552531 CAGGGGCTGTGAAGAGAACAGGG - Intergenic
1067781944 10:49214089-49214111 CAGGGGGCCTAAAGGGAAAATGG - Intergenic
1067784158 10:49230266-49230288 CAGGGGCCCGGGAGGAAAGATGG + Intergenic
1068350031 10:55831244-55831266 TAGAGGCTTTGGAGGGAGAATGG - Intergenic
1069571153 10:69495161-69495183 GAGGGGCTCTGGAGGGCAAAGGG + Intronic
1069727015 10:70586631-70586653 CAGGGGCTATGGAGACAAAGAGG + Intergenic
1069751224 10:70746411-70746433 CAGGGGCTGGGGAAGGAAAGAGG + Intronic
1070756084 10:78994108-78994130 CAGAGACTCTAGAGGGGAAATGG - Intergenic
1070795575 10:79214546-79214568 AAGGGGCTCTGGGGCTAAAAGGG - Intronic
1070922567 10:80197404-80197426 GAGGGGATCTGGAGAGAAACAGG - Intronic
1072624792 10:97104305-97104327 CAGGGTCGCTGGAGTGAGAAAGG + Intronic
1072669582 10:97419548-97419570 AAGGGGCAGTGGAGGGTAAAAGG + Intronic
1073156942 10:101354498-101354520 GCGGGGCCCTGGAGGGAAAGGGG + Intronic
1074183186 10:111080306-111080328 CAGTGGCCCTGGAGGGAGAGAGG - Exonic
1075121175 10:119666096-119666118 CAGAGGGCCTGGAGGGTAAAGGG - Intronic
1075997965 10:126893465-126893487 CAGATGCGCTGCAGGGAAAAGGG - Intergenic
1076069919 10:127480899-127480921 CAGAAGCTCTCCAGGGAAAATGG + Intergenic
1076873048 10:133202896-133202918 CCGGGGCTGGGGAGAGAAAAGGG + Intronic
1077101054 11:822584-822606 CAGGGGCTCCGGCGGGAAGAGGG - Exonic
1077445588 11:2589177-2589199 CACGGGCTCTGGTTGGAAAGTGG + Intronic
1077485538 11:2836844-2836866 CAGGGGCCCTAGAGGGAAATGGG + Intronic
1077508424 11:2942825-2942847 CAGGGGCTGAGTCGGGAAAAAGG + Intergenic
1077543507 11:3158844-3158866 CAGGGCCTCGGGAGTGAAGAGGG + Intronic
1077593076 11:3507917-3507939 GAGGGGCTCTGGAGGGCGAGGGG + Intergenic
1078064728 11:8070949-8070971 CAGGGGGGCTGGAGGGAAAGGGG + Intronic
1078270352 11:9789053-9789075 CAGGGGCCCTGGAGGCATGAGGG - Intronic
1078642375 11:13108638-13108660 CAGGGCTTGTGGAGGGAAGAGGG + Intergenic
1079437925 11:20476488-20476510 CTGGGTTTCTGGAGGAAAAATGG + Intronic
1080666046 11:34337257-34337279 CAGGGGCTGTGTAGGGAAGGAGG + Intronic
1080966265 11:37217953-37217975 CAGAGGCCTAGGAGGGAAAATGG - Intergenic
1081926163 11:46830552-46830574 TAGGGGCTCTGGAGGGAGTGTGG + Intronic
1082663496 11:55945242-55945264 CAGGGGCTGAGGTGGGAGAATGG - Intergenic
1083139042 11:60706501-60706523 TGGGGGCTCTGGAGGGGAGAAGG - Intronic
1083593249 11:63907314-63907336 CAGGGGGTCTGGAGAGAGCAGGG + Intronic
1083764855 11:64836812-64836834 CAGGGCCTCTGGAGGGGAGGTGG + Exonic
1083833335 11:65247611-65247633 CTGGGGCTGTGGAGGGAGAACGG + Intergenic
1084248912 11:67880638-67880660 GAGGGGCTCTGGAGGGCGAGGGG + Intergenic
1084522768 11:69674759-69674781 CAGGGGCTCTGGAGGGAAAAGGG + Intronic
1084617465 11:70246104-70246126 CAGGGGCTCTGTGAGGAGAATGG - Intergenic
1084699784 11:70778960-70778982 GAGGGGCTGTGGAGAAAAAAAGG + Intronic
1084823906 11:71714832-71714854 GAGGGGCTCTGGAGGGCGAGGGG - Intergenic
1085247055 11:75110359-75110381 CAGGTGCTCTGGAGTGTGAAAGG + Intronic
1085508319 11:77072608-77072630 CAGAGGCTCTGAGGGGAAAGAGG - Intronic
1087172157 11:95060183-95060205 CAGGGACTCTGGAGCTCAAATGG - Intergenic
1087888925 11:103514311-103514333 CAGAGGCTGGGGAGGGTAAAGGG + Intergenic
1087955564 11:104282785-104282807 CAGGGGTAATGGAGGGAATAAGG - Intergenic
1088835934 11:113577996-113578018 CTGGGGCTGAGAAGGGAAAAGGG + Intergenic
1088932459 11:114366039-114366061 CACAGGCACTGGAGGGAACAAGG - Intergenic
1089179049 11:116568216-116568238 CAGGGGTTCTGGAGGGAGGGAGG + Intergenic
1089574878 11:119434982-119435004 AAGGGGCTGTGGAGTTAAAAGGG - Intergenic
1090740718 11:129657857-129657879 CAGGAGCTGTGCAGGGCAAAGGG + Intergenic
1091870569 12:3887208-3887230 CGGGGGCTTTAAAGGGAAAACGG - Intergenic
1092085793 12:5758416-5758438 GTGGGGCTGTGGAGGGAAATAGG - Intronic
1092419196 12:8316060-8316082 GAGGGGCTCTGGAGGGCGAGGGG + Intergenic
1092574656 12:9767233-9767255 CAGGGCTTGTGGAGGGAAATGGG - Intergenic
1093034215 12:14317877-14317899 CAGTGGCTCTGGAGGGAGCATGG - Intergenic
1093692620 12:22125181-22125203 CAGAGGCTTAGGAGGAAAAATGG + Intronic
1095103583 12:38205825-38205847 CAGGGGCCCAGGAGGGAGCAGGG + Intergenic
1095418188 12:41998619-41998641 AAGGGCCTCTGAAGGGGAAAGGG - Intergenic
1096181163 12:49551151-49551173 CAGGTGCTCTGGGGGGAATTGGG + Intronic
1096657740 12:53102189-53102211 CAGGGCCACTGGAAGGAACATGG + Exonic
1096808519 12:54155304-54155326 CTAGAGCTCTGGAGGGAAGAGGG - Intergenic
1096843534 12:54392842-54392864 CCTGGGTTCTGGAGGGAAATTGG + Intergenic
1096846017 12:54407528-54407550 CATGGGCTCTGGAGGCAGACTGG - Intronic
1097141934 12:56909294-56909316 CAGAGGCCTAGGAGGGAAAATGG + Intergenic
1097967026 12:65592273-65592295 CAGGCTCTCTGAAGGGATAAAGG - Intergenic
1097988994 12:65814730-65814752 CAGGGGCTGAGGCAGGAAAAGGG + Intergenic
1098052699 12:66471131-66471153 AAGTGGCTCTGGAGGTAAAAAGG + Intronic
1098360154 12:69646635-69646657 CTGATGCTCTGCAGGGAAAAAGG - Intronic
1098749059 12:74272312-74272334 CTGGGGCCCTGTTGGGAAAATGG + Intergenic
1099975848 12:89544840-89544862 CAGGAGGTCTGCAGGGACAAAGG + Intergenic
1100715202 12:97298348-97298370 CAGCTGTTCTGGAGGGAATATGG + Intergenic
1100757651 12:97769665-97769687 CAGGGGCTATGGAGACCAAACGG - Intergenic
1101292881 12:103389121-103389143 TAGGGGCTCTTGAGAGAAACTGG + Intronic
1101301901 12:103491870-103491892 CCAGGACTCTGAAGGGAAAAAGG + Intronic
1102828049 12:115967396-115967418 CAGGTGCTCAGGATTGAAAAAGG + Intronic
1103206564 12:119134057-119134079 TATGGGCTCTGGAGGTAAAGAGG + Intronic
1103398938 12:120629189-120629211 GAGTGGATCTGGAGGGCAAATGG + Intergenic
1103612965 12:122135263-122135285 CAGGGCCTCTGAAGAGAGAAGGG + Exonic
1103972674 12:124681912-124681934 CAGGGGCTTTGGAGGGAGCAGGG - Intergenic
1104041383 12:125133608-125133630 CAGGGGCAGTGGAGGGCACAGGG - Intronic
1104289518 12:127455404-127455426 CAGGGCCTCGGGAGGGTGAAGGG + Intergenic
1104814671 12:131638816-131638838 GAGGGGCTCTGAGGGGAACATGG + Intergenic
1104970347 12:132528098-132528120 CTGGGGCTCCAGAGGGAAAGCGG - Intronic
1104996869 12:132663587-132663609 GAGGGGCTATGGTGGGAAATGGG + Intronic
1105694091 13:22871393-22871415 CAGAGGCCTGGGAGGGAAAATGG + Intergenic
1105892184 13:24689720-24689742 CTGGGGCTCAGGAGCAAAAATGG - Intronic
1106234522 13:27850866-27850888 AAGGGACTCTGGAAGGAAACGGG - Intergenic
1107462401 13:40616739-40616761 CAAGGGGTGTGGAGGGAAGAAGG + Intronic
1107715134 13:43192409-43192431 CCGGGGCGGTGGGGGGAAAACGG - Intergenic
1107753526 13:43594834-43594856 CAGAGTCTCTTGAAGGAAAATGG - Intronic
1107792773 13:44018678-44018700 CTGGGGCCCAGGAGGGGAAAGGG + Intergenic
1108163361 13:47666221-47666243 CAGGTGCTCTGGCAGGTAAAGGG - Intergenic
1108708957 13:53014991-53015013 CAGAGGCTCTGTGGGGAAACTGG + Intergenic
1111340627 13:86881428-86881450 TAGGGACTCTGGAGGGGATATGG + Intergenic
1112164582 13:96904497-96904519 CAGTAGCTCTGCAGGGAAGAGGG + Intergenic
1112601309 13:100858288-100858310 CAGAGGCTGAGGAAGGAAAATGG - Intergenic
1113535932 13:111066291-111066313 CAGGGGCTGGGGAGGGCAATGGG + Intergenic
1113554285 13:111219170-111219192 CAGGGGCTGGGGAGGGGAATGGG - Intronic
1113567105 13:111325692-111325714 CGGTGGGTGTGGAGGGAAAATGG + Intronic
1113608050 13:111624264-111624286 GAGGGGCTTTGCAGGGAAATAGG - Intronic
1113736078 13:112679941-112679963 CCGAGGCTCTGGAAGGTAAAGGG - Intronic
1115051893 14:29072815-29072837 CAGAGGCTTAGGAGGAAAAATGG - Intergenic
1115369035 14:32591208-32591230 CAGGGCCTCTGGAAGTCAAATGG + Intronic
1116471582 14:45291810-45291832 CTGGGGTGCTGGAGGGGAAATGG + Intergenic
1117044705 14:51801555-51801577 CAGGGGCTCTGCAGGTCAAGCGG + Intergenic
1117581693 14:57157807-57157829 TAGGAGCTCTGGAGTGAAGATGG - Intergenic
1117722146 14:58638284-58638306 GAGGGGCGCTGGCGGGAGAAGGG + Exonic
1118318429 14:64739303-64739325 CAATGGCTCTAGAAGGAAAAGGG + Intronic
1118320264 14:64748725-64748747 CAGGGGCTCTGGGGGGCTGAGGG - Exonic
1118888970 14:69891544-69891566 CAGGGGGTAGGGAGGGAAGAGGG - Intronic
1119759957 14:77143264-77143286 AAGCTGCTCTGAAGGGAAAAGGG - Intronic
1120646272 14:87078295-87078317 TGGGGGCTGTGGTGGGAAAAAGG - Intergenic
1121099993 14:91243898-91243920 GAGGCGATCTGGGGGGAAAATGG - Exonic
1121271278 14:92639688-92639710 CAGGGGCCCGGAAAGGAAAAGGG - Intronic
1121627077 14:95393686-95393708 CTGGGGCTCCAGAGGGATAAGGG - Intergenic
1121685259 14:95830955-95830977 CAGGAACTCTGGAGGGAAAGGGG - Intergenic
1122012272 14:98759985-98760007 CTGGAGCTCAGGAGGAAAAATGG - Intergenic
1122079327 14:99256190-99256212 CATGGGCTCTGGAGGGACTCAGG - Intronic
1122258688 14:100499737-100499759 CAGGAGCTCTGGAAGGAAGGAGG - Intronic
1122265184 14:100543402-100543424 CAGGGTCTGTGGAGGGCAACTGG + Intronic
1122284022 14:100640222-100640244 AAGGGGCTCTGCAGGGCAGAGGG - Intergenic
1122906740 14:104805131-104805153 CAAGGCCTCTGGAGGGAGCAGGG - Intergenic
1124029055 15:25992603-25992625 CATGGGCTGTGGAGGGTAGAGGG - Intergenic
1124356195 15:28996582-28996604 CAGCGGCTTTGTAGGGAAACTGG + Intronic
1125687824 15:41573831-41573853 AGGGGGCTCTGGAAGGAAAGGGG + Intronic
1128087964 15:64898691-64898713 CTGGGGATCTGGAGGGCAAATGG + Intronic
1128151839 15:65368207-65368229 CAGGCACTCTGGAGAGAAGAGGG + Intronic
1128536114 15:68491851-68491873 CAGGGGGGCTGGAAGGAAGAGGG + Intergenic
1128808869 15:70555518-70555540 AGGGAGCTCTGGAGGGAAAATGG + Intergenic
1129625708 15:77196586-77196608 CATGGGCTTTGGAGAAAAAAGGG + Intronic
1129632591 15:77277840-77277862 CAGGGGCTGGAGAAGGAAAAGGG + Intronic
1129872914 15:78952425-78952447 CAGGGTTTCTGGAGAGAAGAGGG - Intergenic
1130099142 15:80878892-80878914 CTGGGGCAGTGGAGGGAAGAGGG - Intronic
1130403459 15:83578272-83578294 CAGGGGCTCCGGAGGGAGGCAGG - Intronic
1130760001 15:86809343-86809365 CAGGGGCTTTTGAGGGTAGAAGG - Intronic
1131470907 15:92696048-92696070 CAGTGGGTTTTGAGGGAAAAGGG + Intronic
1131880823 15:96860164-96860186 CAGGGGCTCTGTGGGAAAACGGG + Intergenic
1131898451 15:97060809-97060831 CACAGACTCTGTAGGGAAAATGG + Intergenic
1132291223 15:100705178-100705200 CTGGGGCTCTGGAGGCAGAGAGG + Intergenic
1132503593 16:296131-296153 CTGGGGCTCCCGAGGGAACAGGG - Intronic
1132688211 16:1171095-1171117 GAGGGGCTCAGCAGGGACAAAGG - Intronic
1132750742 16:1456284-1456306 CAGGGGCTGTGCAGGGGAAGGGG + Intronic
1132782702 16:1636850-1636872 CAGTGGCTCTTGAGGAAAGAGGG + Intronic
1132851789 16:2028107-2028129 CAGGGGACCTGGAGGAAAAGGGG - Intronic
1132978424 16:2721586-2721608 CTGGGGGTCTGGAGGGAAGGAGG + Intergenic
1133328862 16:4958838-4958860 CAGGGTGTCTGGGAGGAAAATGG + Intronic
1133358708 16:5156531-5156553 AAGGGGCTCTGGAGGGCGAGGGG + Intergenic
1133749478 16:8713305-8713327 AAGAGGCCCTGGAAGGAAAAAGG + Exonic
1135547719 16:23377089-23377111 CAGAGGCTCAGCAGGGAACAGGG + Intronic
1136121300 16:28136962-28136984 CAGGGACACTGGAGGGAGACTGG + Intronic
1136271886 16:29153499-29153521 CAGAGCCTCTGGAGGGAGTATGG - Intergenic
1137017730 16:35393683-35393705 CAGGGGCCCAGGAAGGAGAAAGG + Intergenic
1137549118 16:49424705-49424727 CTGGGGTTCTGGAAGGAAAGGGG + Intergenic
1137627388 16:49918062-49918084 GAGGGGCTGTGGAGCGACAAGGG + Intergenic
1137699937 16:50490214-50490236 CATGGGCACTGGAGGGAGGATGG + Intergenic
1137837430 16:51606282-51606304 CAGGAGCTCTGGAGTGCAAATGG - Intergenic
1138137160 16:54533060-54533082 CAGGGGCTAGGTAGGGAAACAGG + Intergenic
1138188377 16:54994681-54994703 CACGGGCTGTGGAGGGAGACTGG + Intergenic
1138611678 16:58129722-58129744 CAGGGGCTGCGCAGGGAAAGCGG + Intergenic
1138751521 16:59428321-59428343 CAGGGGCTCAAGAGTGAGAAAGG + Intergenic
1138846250 16:60570394-60570416 CAGGGACTGGGGAGGGGAAATGG + Intergenic
1141237245 16:82229972-82229994 CTGGGCCTCAGGAGGGACAAGGG - Intergenic
1141473516 16:84255609-84255631 CAGGGACTCTGGTGGGAACTGGG - Intergenic
1141629917 16:85281826-85281848 CAGGAGCTCTGGAAGCAAAGCGG + Intergenic
1141696852 16:85624265-85624287 CAGGGCCTCTGGAGGGAGGAAGG + Intronic
1141729914 16:85815194-85815216 CAGGGGCTGGGGAGGGGAAATGG - Intergenic
1141852029 16:86652990-86653012 CAGAGGGTCTGGAGGGAAGAAGG - Intergenic
1141909041 16:87046061-87046083 CACGGGCTCTGGAGCCCAAATGG - Intergenic
1142418314 16:89955154-89955176 CAGGGCCTCTGGAGGAAGACGGG - Exonic
1142670255 17:1484812-1484834 CAGGTGCTTTGGAGGACAAATGG + Intronic
1144240970 17:13311239-13311261 CCTGGGATCTGGAGAGAAAATGG - Intergenic
1144653168 17:17019544-17019566 CAGGTGCCCTGCAGTGAAAATGG - Intergenic
1144665458 17:17099025-17099047 GAGGGGCTTTGGAGGGAGGAGGG + Intronic
1144750676 17:17646189-17646211 CAGGGGCTGGGCAGGGGAAATGG + Intergenic
1146098319 17:29954304-29954326 CAGAGGCCTAGGAGGGAAAATGG + Intronic
1146329497 17:31916369-31916391 CGGAGGCTGTGGAGGGAGAATGG - Intergenic
1146370710 17:32264359-32264381 CAGGGGAACTGGAAGGAGAAGGG - Intergenic
1146406098 17:32539506-32539528 TAGAGGCTCTGGAGGGAACATGG - Intronic
1146508515 17:33425962-33425984 CAGGGACTCTGGAGAGAGAGGGG + Intronic
1147330555 17:39696546-39696568 CTGGGGCTCTTGAGGGTAATGGG + Intronic
1147656874 17:42096172-42096194 CAGGGGCTGTGGATGGAGCAAGG - Intergenic
1147786115 17:42979991-42980013 CAGGGAATCTCCAGGGAAAAGGG + Intronic
1147793817 17:43028810-43028832 CAGGGGAGCTGGAGGGCAGAAGG + Exonic
1148554659 17:48571284-48571306 GAGGGGGTCTGGTTGGAAAACGG - Intronic
1148645548 17:49217970-49217992 CTGGGGTTCTGGAGGGAAAGGGG - Intronic
1148868904 17:50643977-50643999 CAGGGGCACTGGAGGGCAGAGGG + Intronic
1149288111 17:55188510-55188532 AAGGTGCTCTGGAGAGAAAGAGG - Intergenic
1149654222 17:58301881-58301903 GACGGGCCCTGGAGGGAGAAAGG - Intronic
1149654356 17:58302481-58302503 CAGGGGGTCAGGAGGGAATCAGG - Intronic
1150135453 17:62692751-62692773 CGGGGGCTCTGGGGAGAAAGAGG - Exonic
1150303356 17:64064176-64064198 CAGGAGCCCTGGAGGGAGAGCGG + Intronic
1151329116 17:73396417-73396439 CAGGGGCTCTGGAGGGCCCTTGG + Intronic
1151790527 17:76302826-76302848 CAGTGCCTCGGGAGGAAAAAGGG - Intronic
1151908959 17:77068924-77068946 CAGGGGCTCTGGAGCTAATCTGG - Intergenic
1152031599 17:77846554-77846576 CAGGGGCTCTGTGGGGAAGGAGG - Intergenic
1152243628 17:79173688-79173710 CAGGGGGCCTGGGAGGAAAATGG + Intronic
1152376459 17:79921188-79921210 CAAGGGCTCTGGTGAGGAAACGG + Intergenic
1152518306 17:80838879-80838901 CAGGGGTGCTGGAAGGACAAAGG + Intronic
1152519660 17:80847785-80847807 CACGAGCTCTGGAAGGAAGAAGG - Intronic
1152956366 18:45256-45278 CAGGGGCCCAGGAGGGAACAGGG - Intergenic
1153084719 18:1271371-1271393 CCTGGGATCTGGTGGGAAAATGG - Intergenic
1153619880 18:6967778-6967800 CACGGGCTCTGGAGAGGGAAGGG - Intronic
1155241780 18:23870820-23870842 CAGGGGCTGGGGAGGGAAAAAGG + Intronic
1155454430 18:25996260-25996282 CAGAGGCTGAGGCGGGAAAATGG + Intergenic
1155673612 18:28402621-28402643 CAGGGGCCCTAGGGGCAAAATGG + Intergenic
1156737464 18:40277896-40277918 CAGAGGCTTTGGAGGGAGCATGG + Intergenic
1157321936 18:46641336-46641358 CAGGGACTAGGAAGGGAAAAGGG + Intronic
1157620819 18:49016678-49016700 CGGGGTCTGAGGAGGGAAAAGGG + Intergenic
1159552238 18:69907119-69907141 CAGGGGATCTGGATTGGAAAGGG - Intronic
1160698918 19:497126-497148 AAGGGGCTCAGGAGAGAGAAGGG + Intronic
1160729964 19:637183-637205 CAGGGCCTCTGGAGGGAGCGAGG - Intergenic
1160896365 19:1403968-1403990 CAGGGGCTGGGGAGGGGACAGGG + Intergenic
1160975533 19:1790549-1790571 GAGGGGCAGTGGAGGGAGAAGGG - Intronic
1161239990 19:3217261-3217283 CAGGGGCTGGGGAGGGAGATGGG + Intergenic
1161898605 19:7100961-7100983 CAGAGTCTCTGTTGGGAAAAGGG - Intergenic
1161931458 19:7343328-7343350 CAGGGGCTGGGGAGGGAGATGGG + Intergenic
1162580727 19:11528773-11528795 CTGGGTCTCTTGGGGGAAAAAGG + Intronic
1162800012 19:13105074-13105096 CAGGTGCCCTGGTGGGAAGATGG + Exonic
1163112693 19:15170893-15170915 CAGGCGCTGGGGAGGGAAAGTGG - Intronic
1163283925 19:16334424-16334446 CAGTGGCTGGGGAGGGAGAATGG - Intergenic
1163394706 19:17052959-17052981 CAGGGCGTCTGGAGGGGAAGAGG + Exonic
1163686169 19:18713006-18713028 CAGGGGCTGGGGAGGGGAACGGG - Intronic
1163709120 19:18835100-18835122 CAGGGGCTGTGGAGGTAGGACGG - Intronic
1164288062 19:23839784-23839806 CAGGGGTTCAGGAGGCAACAGGG - Intergenic
1165121072 19:33558867-33558889 CAGGGGCTCTGGAGGCCGCACGG + Intergenic
1165349832 19:35269419-35269441 CAGGGGCACAGGAGGGAGCAGGG - Intronic
1165521857 19:36320656-36320678 CAGGGGCTGAGGTGGGAAAATGG + Intergenic
1165633957 19:37324877-37324899 CAGGGGCTGAGGTGGGAGAATGG - Intronic
924963619 2:56925-56947 CAGGGGCTGTGGTGGGAAGTGGG + Intergenic
925294648 2:2768943-2768965 GAAGGGACCTGGAGGGAAAAGGG - Intergenic
926447810 2:12965556-12965578 CAGGGTAGCTGGAGGGAAGATGG - Intergenic
926894311 2:17667915-17667937 CAAGGGCTGTGGAGTCAAAATGG + Intronic
926926447 2:17993093-17993115 CAGGGGCCTAGGAGGAAAAATGG + Intronic
927486548 2:23492040-23492062 CAGAGGAACTGGAGGGAAAAAGG - Intronic
927500470 2:23579577-23579599 AAGTGGGACTGGAGGGAAAAGGG - Intronic
927502570 2:23592292-23592314 CAGGGGCTCAGGATGGGAATCGG - Intronic
927874014 2:26642398-26642420 CAGGGTCTCTGCAGGAACAAAGG + Intergenic
928024433 2:27728356-27728378 CTGGGGCTCTGGAAAGAGAATGG + Intergenic
928179405 2:29057398-29057420 CAGGGGCTTTGGAGTCAAACAGG - Exonic
929450008 2:42030488-42030510 GAGGGGCCTTGGGGGGAAAAGGG + Intergenic
929630080 2:43450931-43450953 CTGGGGCACTGGAGGAAAAGGGG + Intronic
929788965 2:45010162-45010184 CAGCGGTCCTCGAGGGAAAAGGG + Intergenic
931557298 2:63519245-63519267 CAGTGGCTCTGCAGGGCAGAGGG - Intronic
932793054 2:74672507-74672529 CAGGCACTCTGGAGAGAACAAGG - Intronic
932861363 2:75295802-75295824 CAGTGGCTCTGTAATGAAAAGGG + Intergenic
932995224 2:76843851-76843873 CATGGGCTTTGGAGACAAAAAGG - Intronic
933284900 2:80375254-80375276 GAGGTCCTCTGGAGGGAAAAGGG + Intronic
933763951 2:85694736-85694758 CAGGGGCTTGGGAGGGAAAGGGG - Intronic
934754027 2:96812856-96812878 TAAGTGCTATGGAGGGAAAAAGG - Intergenic
934851208 2:97702368-97702390 CAAGGGGCATGGAGGGAAAATGG - Intergenic
934893124 2:98087703-98087725 CCTGGGCTTTGGAGGGAACATGG + Intronic
935194913 2:100807511-100807533 CAGAGGCTCAGGAGGGAGAGAGG + Intergenic
935216006 2:100975841-100975863 CAGGGGCTCTGGGGGTATGAGGG - Intronic
935222358 2:101026570-101026592 CCTGGGCTCAGGAGGGAAAGGGG + Intronic
935637077 2:105257416-105257438 CAGGGGCTGGGAAGGGAGAAAGG - Intergenic
936718306 2:115216381-115216403 CAAGGTCTCTGGAGAGATAATGG + Intronic
937002737 2:118482999-118483021 CTGGGGTTCTGGAAGGAAATGGG + Intergenic
937062474 2:118990850-118990872 CAGGGGCTGAGGATGGCAAAGGG + Intronic
938394417 2:130932060-130932082 CAGGGTCTGGGGAGGGGAAATGG - Intronic
938663848 2:133513501-133513523 GAGTGGATCTGGAGGGAAAATGG + Intronic
938686427 2:133742417-133742439 CAGAGGCCCTGGAGGAAAAAGGG - Intergenic
939083806 2:137693293-137693315 GAGTGGGTCTAGAGGGAAAAAGG - Intergenic
940326819 2:152434308-152434330 CAGGGGGTATGGAGGAATAAAGG + Intronic
940495212 2:154418574-154418596 CAGACCCTCTGGAGGGAAAGAGG + Intronic
940882122 2:158957190-158957212 CAGAGCCTCTGGAGGGAGGATGG + Intergenic
942229591 2:173847691-173847713 GAGGGGCTCTGGAGGGCAGAAGG + Intergenic
943524975 2:189005139-189005161 CAGTGACTCTGGATGGCAAAGGG - Intronic
944621172 2:201517311-201517333 CAGGGGTTGGGGAGGGGAAATGG - Intronic
945815176 2:214596821-214596843 CAGGGACACTGGAGGCAAATGGG - Intergenic
946154986 2:217801377-217801399 CTGGGTGTCTGGAGGGAAGAGGG - Exonic
947946014 2:234102858-234102880 CTGGAGCTCTGGTGGAAAAAAGG + Intergenic
948138902 2:235658697-235658719 CAGGAACTCTGGAAGGAAACGGG + Intronic
948372569 2:237498939-237498961 CAGAGGGTCAGGAGGGACAAAGG - Intronic
948540236 2:238686082-238686104 ATGGGGCTGTGGAGGGAGAAAGG - Intergenic
948585482 2:239016287-239016309 CAATTGCTCTGGAGGGATAAAGG - Intergenic
948596343 2:239082064-239082086 AAGGGCCTCTGGGGGGAAAGGGG - Intronic
948734632 2:239993800-239993822 AAGGGGGTCAGCAGGGAAAAAGG + Intronic
948878876 2:240845680-240845702 CAGAGGCCTAGGAGGGAAAAAGG + Intergenic
948912821 2:241013235-241013257 CAGGGGCTGAGGTGGGAAATGGG - Intronic
1168991772 20:2102123-2102145 CAGGGGCTCCAGGGGGGAAACGG + Exonic
1169260109 20:4131498-4131520 CAGGGGCTCTGGAGGAGGGAGGG + Intronic
1170316289 20:15044470-15044492 GAGTGGGTCTGGAGGGCAAATGG - Intronic
1170555654 20:17512921-17512943 CAGGGGCACTGGCGGGTAAAGGG - Intronic
1171016561 20:21547413-21547435 CAGGGGCTGGGGAGGGAGAATGG + Intergenic
1171966964 20:31537871-31537893 CAGGGGTTCTGAAGGGATAAGGG - Intronic
1172010453 20:31843153-31843175 GAGGGCCTCTGGAGGGGAGAGGG + Intergenic
1172120082 20:32593264-32593286 GTGGAGGTCTGGAGGGAAAAGGG + Intronic
1172168562 20:32914290-32914312 CAAGGGCTCTGGGGGCAGAATGG - Intronic
1172392998 20:34578977-34578999 CTGAGGCTCTGAAGGGAAAGTGG - Intronic
1172731997 20:37096087-37096109 TAGGAGCTCCGGAGGAAAAACGG - Intergenic
1172852022 20:37973257-37973279 CATGGGCTCTGGAGATAAGAAGG - Intergenic
1173191528 20:40880450-40880472 CAGGGGCACTAGAGGGAGACTGG + Intergenic
1173362097 20:42353947-42353969 CAGGGGCTGAGGTGGGAAGATGG + Intronic
1175073092 20:56351060-56351082 CAGGGTCTTTGGAGGCAAACGGG - Intergenic
1175340266 20:58224526-58224548 CAGTGGCCCTGGAGGGAAGCAGG - Intronic
1175493797 20:59398463-59398485 GAGGGGGTGTGGGGGGAAAAGGG - Intergenic
1175539115 20:59737160-59737182 CAGGGGCTATGATGGGAAAGGGG - Intronic
1175547608 20:59788694-59788716 CAGGGCCTCTGCAGGGACAGTGG - Intronic
1176177620 20:63736165-63736187 CAGGGTCTCTGGGGAGAGAAGGG + Intronic
1179435953 21:41362262-41362284 AAGAGGCTCTGGAGGGGAAGTGG + Intronic
1179520573 21:41941753-41941775 GAGGGACTCTTGGGGGAAAATGG - Intronic
1179999685 21:44989755-44989777 CAGCGGCTCTGGAGGGCATCGGG - Intergenic
1180006860 21:45026797-45026819 CAGGGCCTCTGGAGTGGATATGG + Intergenic
1180081654 21:45490119-45490141 CAGGGGCTGTGGAGGGATGGAGG - Intronic
1180119408 21:45736874-45736896 CAGTGGCTGTGGAGGAAACAGGG + Intronic
1180766540 22:18348835-18348857 CAGGGGCTCTGGCCGGACATAGG + Intergenic
1180779774 22:18513543-18513565 CAGGGGCTCTGGCCGGACATAGG - Intergenic
1180812489 22:18770864-18770886 CAGGGGCTCTGGCCGGACATAGG - Intergenic
1181022887 22:20112789-20112811 CAGAGGCTGTGGGGGGAAAAGGG + Exonic
1181198647 22:21205111-21205133 CAGGGGCTCTGGCCGGACATAGG - Intergenic
1181259982 22:21590836-21590858 CTGGGGCTTTGGGAGGAAAAAGG - Intronic
1181401091 22:22650689-22650711 CAGGGGCTCTGGCCGGACATAGG + Intergenic
1181648430 22:24246195-24246217 CAGGGGCTCTGGCTGGACATAGG - Intergenic
1181703062 22:24631769-24631791 CAGGGGCTCTGGCCGGACATAGG + Intergenic
1181724911 22:24805038-24805060 CAGGGGCTCTTGATGGAACAAGG + Intergenic
1182288422 22:29261023-29261045 CAGAGGCTCAGAAAGGAAAAGGG + Intronic
1182503824 22:30767855-30767877 CACGGGCCCTGCAGGGTAAAGGG + Intronic
1182991949 22:34776604-34776626 AAGGTGATCTGGAGGGAAATTGG + Intergenic
1183166589 22:36152154-36152176 AAAGGGCTCTGTAGGGAAAGGGG + Intronic
1183239719 22:36648595-36648617 CAGGGGCCCTGGAGAGAGAAGGG - Intronic
1183688696 22:39376233-39376255 CAGGGGCTCAGTGGGGAAAGGGG - Intronic
1184333701 22:43841178-43841200 CAGGGGCCCTGGAGGGCCACAGG + Intronic
1184629032 22:45761351-45761373 CAGGGGCCCTGGAGAGAATGAGG - Intronic
1184675011 22:46036783-46036805 CAGAGGCCCTGGAGGGCAAAGGG + Intergenic
1184730102 22:46367111-46367133 AAGGGGCCCTGGAGGGAGGAAGG + Exonic
1185070643 22:48654004-48654026 CGGCGGCTCTGGAGGGAAGGGGG + Intronic
1185070667 22:48654111-48654133 CCGCGGCTCTGGAGGGAAGAGGG + Intronic
1185085325 22:48737780-48737802 CAGGGCCTCCGCAGGGCAAATGG + Intronic
1185108780 22:48889340-48889362 CGGGGGCACTGGAGGGGAGAGGG - Intergenic
1203228158 22_KI270731v1_random:89726-89748 CAGGGGCTCTGGCCGGACATAGG + Intergenic
949262614 3:2119889-2119911 TAGGGGCTCTGAAGGAGAAAAGG + Intronic
949826554 3:8171489-8171511 CAGGGACTCTTGAGAGAAAAAGG + Intergenic
950522678 3:13505918-13505940 CAGGGGCTGGGGAGGGAAAGTGG + Exonic
950526863 3:13529348-13529370 CAGGAGGGATGGAGGGAAAAGGG - Intergenic
950704167 3:14769755-14769777 TAGGGGCACTGGATGGAAGAGGG + Intronic
950965674 3:17144138-17144160 CAGGGGCTGAGGAGGGAAGAAGG - Intergenic
951089520 3:18556043-18556065 CAGGGGATTTGGAGGAAAGATGG - Intergenic
952188830 3:31000457-31000479 CAGGGACACTGGAGGCTAAAAGG - Intergenic
952555557 3:34526039-34526061 CAGTGGCTGTGGAGGGAGAGAGG - Intergenic
953190679 3:40684406-40684428 CAGGAGGTTTGGAGGGCAAAGGG - Intergenic
953853215 3:46481479-46481501 CCTGGGCTCTGGAGAGTAAAGGG - Intronic
954217560 3:49132969-49132991 CAGAGGGCCTGGAGGGAAACAGG - Exonic
954464391 3:50646063-50646085 CAGGGGCTTTTGAGGGGAAATGG + Intronic
955294952 3:57726544-57726566 AAGGGGCTCTTGAGGGAGACTGG + Intergenic
955398992 3:58577786-58577808 AAATGGCTCTGGGGGGAAAAGGG + Intronic
955489903 3:59471576-59471598 CAGGTGCTCTGCAGGGGAAGTGG - Intergenic
956170116 3:66426550-66426572 CATGGGCACTGGAGGGACAATGG - Intronic
957063180 3:75498806-75498828 GAGGGGCTCTGGAGGGCGAGGGG + Intergenic
958044533 3:88267366-88267388 CAGGTGCTCTTGAGAGAAAAGGG + Intergenic
958588121 3:96117891-96117913 CAGAGGCTCTGGAGAAAAAGTGG + Intergenic
958636869 3:96755907-96755929 CAGTGGCTCTGCTGGGAATATGG + Intergenic
958955195 3:100459025-100459047 CAGGGGCCTAGGAGGAAAAATGG - Intergenic
959615515 3:108342897-108342919 CAGGTGCTGTGGAAGGAAACAGG - Intronic
961290220 3:125840771-125840793 GAGGGGCTCTGGAGGGCTAGGGG - Intergenic
961896879 3:130175255-130175277 GAGGGGCTCTGGAGGGCGAGGGG + Intergenic
962896713 3:139722066-139722088 TAGGGGCTCAGGATGGAAAAGGG - Intergenic
963247310 3:143075065-143075087 CTGGGTCTCTGGAGGAAAACCGG + Intergenic
963448730 3:145449226-145449248 CATGGTCTATGGAGGGAAAGAGG + Intergenic
963602408 3:147389971-147389993 CAGGGGTTGGGGTGGGAAAAAGG + Intronic
963766689 3:149343496-149343518 GAGGGACTCTGGAAGAAAAAGGG - Intergenic
964999361 3:162933102-162933124 CAGGGGCTGGGGAGGGGAATTGG - Intergenic
965520521 3:169664849-169664871 CAAAGGCTGTGGAGGGAAAGGGG + Intergenic
966054062 3:175660661-175660683 CAGAGGCTGGGAAGGGAAAAGGG - Intronic
966886900 3:184381851-184381873 CCGGGGCCCGGGAGGGAAACTGG + Intronic
966913339 3:184571303-184571325 GAGGGTCTCTGGAGGAACAACGG - Exonic
966921292 3:184613296-184613318 CAGAGGTTCTGGAGGGAATGAGG - Intronic
967185831 3:186943853-186943875 CATGGGCTCTGGAGGCAAGCAGG - Intronic
967571419 3:191033096-191033118 AAGAGCCTCTGGAGGGAGAATGG + Intergenic
967887993 3:194346223-194346245 CCCGGGCTCTGCAGGGAAGATGG + Intronic
968264262 3:197350497-197350519 CAGGGGCTGGGGAGGGAGGAAGG - Intergenic
968357969 3:198122990-198123012 CAGGGGTCCAGGAGGGAACAGGG + Intergenic
968890341 4:3365342-3365364 CAGGGAGTCTGGAGGGAGGAGGG + Intronic
969007068 4:4028813-4028835 GAGGGGCTCTGGAGGGCGAGGGG + Intergenic
969352583 4:6606315-6606337 CAGTGGCTCCTGAGGGAAAGTGG + Intronic
969392748 4:6901971-6901993 CAGCGGCTCTGGAGGGAGACAGG + Intergenic
969586392 4:8096709-8096731 CAGGGGCTGGGGAGGGAAGGGGG + Intronic
969591481 4:8124418-8124440 CAGGGGCTGCGGAGGGAAAACGG - Intronic
969805905 4:9608644-9608666 GAGGGGCTCTGGAGGGTGAGGGG - Intergenic
971236712 4:24849079-24849101 AAGGGGATCAGGAGGAAAAAAGG - Intronic
972051711 4:34743260-34743282 CAGAGGCTTAGGAGGGAAAATGG - Intergenic
972403208 4:38724261-38724283 CAGAGCCTCTGGGGAGAAAAGGG - Intergenic
975837043 4:78434346-78434368 CATGGGTTCTGGAGTTAAAATGG + Intronic
976320590 4:83710162-83710184 CAGGGACCATGGAGGGGAAATGG - Intergenic
977552399 4:98456385-98456407 CAGGGGCCCTGCAAGGGAAAGGG - Intergenic
977563735 4:98560767-98560789 CAGGGGCTCTAAAGTAAAAAAGG + Intronic
977822210 4:101486269-101486291 CAGGGGCTATGGAGAGGAGAGGG - Intronic
978383270 4:108153103-108153125 GAGGTGCTGGGGAGGGAAAAGGG - Intronic
979984421 4:127296135-127296157 CAGAGGCCTAGGAGGGAAAAAGG - Intergenic
981822507 4:148902042-148902064 CCTGGGCTGAGGAGGGAAAAAGG + Intergenic
984541188 4:181039621-181039643 CAGGGGGTGGGGAGGGATAAGGG - Intergenic
984624873 4:181995968-181995990 CTGGGGCTCTTGAGGGAGGAAGG - Intergenic
984832778 4:183991158-183991180 TAGGGACTTTGGAGAGAAAAAGG - Intronic
986773292 5:10992855-10992877 CAGGCTCTCTGGAGGGAAGGAGG - Intronic
986963371 5:13242095-13242117 CAGGGGCTCTGTCGGGAACATGG - Intergenic
987333050 5:16873882-16873904 CAGAGGCCCAGGAGGAAAAATGG - Intronic
988009170 5:25461573-25461595 CAGAGGCCCAGGAGGAAAAAGGG + Intergenic
988067846 5:26245152-26245174 CTGGGGCTGTGGATGGAAACTGG - Intergenic
988400100 5:30751366-30751388 CCAGGGGTCTGGAAGGAAAAGGG - Intergenic
988479558 5:31618652-31618674 CAGAGGCTCGGGAGAGAAAAAGG + Intergenic
988666226 5:33330823-33330845 AAGGGGTTCTGAAGGGAAAGGGG - Intergenic
989412775 5:41139793-41139815 CACTGGCACTGGAGGGAAGAAGG - Intergenic
989635108 5:43523608-43523630 AAGGGGCTTTAGAGGGAAAGGGG + Intergenic
990920907 5:60965519-60965541 CAGGGGCTGGGGTGGGGAAATGG - Intronic
991643392 5:68776489-68776511 CAAGTTCTCTGGAGGGAAGAGGG + Intergenic
991666759 5:69006981-69007003 GAGGGGCACAGGAGGGAAGAAGG + Intergenic
992319936 5:75603886-75603908 CAGGGTCTTTGTAGGGAAACAGG - Intergenic
992784432 5:80156038-80156060 TGGGGGCTCTGGAGGGCGAAGGG + Intronic
992982338 5:82188694-82188716 CAGAGGACCTGGAGGGGAAATGG + Intronic
993039549 5:82797267-82797289 TATGTCCTCTGGAGGGAAAAGGG - Intergenic
993507876 5:88733327-88733349 CAGAGGCTCTGGAGGGATGCAGG + Intronic
993944041 5:94097054-94097076 CAGAGGCTCTGGTGCGGAAACGG + Intronic
994541021 5:101097371-101097393 CAGAGGCTCAGGAGGGTAATGGG + Intergenic
994775130 5:104030354-104030376 CTGGGCCTATAGAGGGAAAAAGG - Intergenic
995011432 5:107260470-107260492 CAGAGGCCTTGGAGGAAAAATGG - Intergenic
995276687 5:110285563-110285585 CAGGTGATCAGGATGGAAAAAGG + Intergenic
995531442 5:113095622-113095644 CGGGGGCTGAGGTGGGAAAATGG - Intronic
995587148 5:113659889-113659911 TAGAGGCTCTGGAGGGAGTACGG + Intergenic
996404734 5:123094112-123094134 GAGGGGCTGGGGAGAGAAAAGGG + Intronic
997601242 5:135139990-135140012 CAGAGGCTGTGGATGGAAAGTGG + Intronic
998053359 5:139054959-139054981 CAGGGGCTCTCGAAGGATACAGG - Intronic
998391224 5:141788244-141788266 CAGATCCTCTGGAGGGGAAAGGG + Intergenic
998398737 5:141836379-141836401 GAGGGCCTCTGGAGGGGAACGGG + Intergenic
998677697 5:144428023-144428045 CAAGGGCTATGAAGGGAAAGAGG - Intronic
999475882 5:151898596-151898618 CAGGAGGTCAGGATGGAAAAGGG + Intronic
999501214 5:152148360-152148382 GAGGGGCGCTGGAGGGGACAGGG + Intergenic
999768661 5:154757916-154757938 AAAGGGCTCTGGAAGGGAAAGGG - Intronic
1000070547 5:157736602-157736624 CAGGTGCCCAGCAGGGAAAATGG - Intronic
1000179500 5:158794250-158794272 CAGTGGCACTGGAGGGACAGAGG + Intronic
1001241644 5:170075932-170075954 AAGGGGATCTGGAGAGAAAGTGG - Exonic
1001271795 5:170318161-170318183 CAGGAGCTGGGGAGGGAGAAAGG + Intergenic
1001948226 5:175797488-175797510 GTGGGGGTCTGGAGGGAAGACGG - Intronic
1003317329 6:5024466-5024488 CAGAGGCTCTGGAGGAGAGAGGG + Intergenic
1003509230 6:6765550-6765572 CAGGAGATCTGGAGGGAACAAGG + Intergenic
1003782120 6:9441163-9441185 AATGGGTTCTGGAGGGAGAAGGG + Intergenic
1003946148 6:11077863-11077885 CAGGAGCTCTGGAGCTAGAATGG + Intergenic
1003983532 6:11412358-11412380 CAGGGGCAAAGGAGGGAAATGGG + Intergenic
1004037591 6:11938813-11938835 CAGGTGCTCCGGAGGGAAAGTGG - Intergenic
1004455346 6:15786739-15786761 CAGGGTCTCTGGTGTGCAAATGG + Intergenic
1005586373 6:27280106-27280128 GAAGGGCTCTGGTGGGAGAAAGG + Intergenic
1007247857 6:40475307-40475329 TAGGGCCCCTGGAGGAAAAATGG + Intronic
1007842842 6:44730799-44730821 CAGGGGGGCTGGAGGGAAGTAGG - Intergenic
1008132325 6:47733103-47733125 CAGGGGGTGTAGAGGGAAAAAGG - Intergenic
1008161785 6:48086555-48086577 CAGGGATTGTGGAGGCAAAAAGG + Intergenic
1009802844 6:68563890-68563912 TAAGAGTTCTGGAGGGAAAAAGG + Intergenic
1009960538 6:70515590-70515612 CAGGGGCTCTGGGGGACAGAGGG + Intronic
1009985779 6:70779526-70779548 CAGGGGCTGTGGTGGGAATGTGG + Intronic
1011364019 6:86560673-86560695 TTTGGGCTCTGGAGGGAAAGTGG - Intergenic
1012464734 6:99504536-99504558 CAGAGGATCTGGAGAGAAATGGG + Intronic
1012908265 6:105092014-105092036 CAGGGGCACGGGAGAGAAAGAGG + Intergenic
1014134009 6:117866757-117866779 CAGAGGCCCAGGAGGAAAAATGG - Intergenic
1014436589 6:121427466-121427488 CAGAGGCTTGGGAGGGAAAGAGG + Intergenic
1015142463 6:129950436-129950458 CACAGGCTTTGGAGGGAAGAGGG + Intergenic
1015330190 6:131968837-131968859 CATGTGCTCTGGAGGAAGAAGGG + Intergenic
1016126272 6:140408238-140408260 CATGGGCCTAGGAGGGAAAAAGG + Intergenic
1016307162 6:142696445-142696467 CAGGGGTTCTGGAGGGAGTTGGG + Intergenic
1017542188 6:155414129-155414151 AAGAGGCTATGGAGGAAAAATGG + Intronic
1018628917 6:165805502-165805524 CAGGGGCTCTTGGTGGAGAAAGG - Intronic
1019016399 6:168883561-168883583 CAGGGACTCAGGAGGGAAGCTGG + Intergenic
1019017542 6:168890809-168890831 CAGGGGCTCAGGAGGTGAAGTGG + Intergenic
1019584194 7:1787876-1787898 CAGGTGCTGTAGAGGAAAAAGGG - Intergenic
1019655391 7:2191624-2191646 CAGAGGCTCAGGTGGGAGAATGG + Intronic
1019747974 7:2711149-2711171 CTGAGGCTGTGGAGGGAAGAGGG + Intronic
1019884509 7:3892403-3892425 CAGGAGCTCCGGAGGGGAAGCGG + Intronic
1020230957 7:6318091-6318113 CAGTGGCTCTAGAGGGAGAGGGG + Intergenic
1021550393 7:21865498-21865520 CAGGGGATGGGGAAGGAAAAAGG + Intronic
1021801827 7:24315004-24315026 CAGGGGCACTGGAGGCAGAGAGG + Intergenic
1021905795 7:25331825-25331847 CAGGGGCTTTGAAGGCAAACAGG + Intergenic
1021932464 7:25595370-25595392 CAGAGGCTCAGGAGGGAAGGAGG - Intergenic
1022209181 7:28191956-28191978 CAGAGGCTGGGGAGGAAAAAGGG + Intergenic
1023337009 7:39180845-39180867 AAGGTGCTCTGGAAGGCAAAGGG - Intronic
1023367159 7:39475425-39475447 GAGGGGCTTTTGAGGGAAGATGG + Intronic
1023745436 7:43318747-43318769 CAGGGTGTCAGGAGAGAAAAGGG + Intronic
1024189428 7:46990672-46990694 CAGGGGCTGGGGAGGGAAAATGG + Intergenic
1024566232 7:50683294-50683316 CAGGGGCTAGGGAAGGAAATGGG + Intronic
1026048976 7:66929152-66929174 CATGGGCTCTGGAGGCCAACTGG + Intronic
1026506987 7:70993334-70993356 CAGAGGCTTTGGAGGAAGAATGG - Intergenic
1026721260 7:72832698-72832720 AAGGGCCTGTGGGGGGAAAATGG - Intergenic
1029211271 7:98910190-98910212 CAGGGGCTGGGGAGGGAGCAGGG - Exonic
1029374092 7:100167623-100167645 GAGGGGCTCTGGAGGAAACCAGG - Intronic
1029574664 7:101395558-101395580 CAGCGGGGCTGGAGGGAAAATGG + Intronic
1030023186 7:105295606-105295628 CAGGGGCCAGGAAGGGAAAATGG + Intronic
1033012232 7:137634983-137635005 CCAGGGCCCTGGAGGGAAACAGG + Intronic
1033278013 7:139987291-139987313 CTGGGGCTCTGGTGTGGAAAGGG - Intronic
1033751859 7:144366255-144366277 CAGGGGTCCAGAAGGGAAAATGG - Intronic
1035046433 7:155970538-155970560 CAAGAGCCCTGGAGGGAAGACGG - Intergenic
1035314301 7:157988642-157988664 CAGGGGGGCTGGAGGGAACCGGG + Intronic
1035673660 8:1439391-1439413 CAGAGGCTCCGGAGGGCACAGGG - Intergenic
1036881840 8:12518476-12518498 GAGGGGCTCTGGAGGGCGAGGGG + Intergenic
1037054531 8:14422921-14422943 CAGGGACTGAGGAGGGAGAATGG + Intronic
1037247773 8:16856255-16856277 CAGGAGATCAGGAGGGAGAAGGG + Intergenic
1037684220 8:21124754-21124776 CAGGCGATCTGGAGAGAAAGAGG + Intergenic
1038056372 8:23862027-23862049 AAGGAGCTCTGGATGGCAAAAGG - Intergenic
1038438926 8:27558325-27558347 CAGGGCCTCAGGAGAGAATAGGG - Intergenic
1041005976 8:53497335-53497357 CTGAGGCTCTGCAGGGCAAAGGG - Intergenic
1041132860 8:54721341-54721363 CTGGAGCTCTGAAGGGAAACAGG + Intergenic
1041782170 8:61589087-61589109 CAGAGGCTGTGGTGGGAAAAGGG + Intronic
1042745875 8:72104846-72104868 CAGGGGCTATGTAGGGGAAGTGG + Intronic
1043492534 8:80763572-80763594 CAGAGGCCTAGGAGGGAAAATGG - Intronic
1044228267 8:89744122-89744144 CAGAGGCCTAGGAGGGAAAATGG - Intergenic
1044281873 8:90365941-90365963 CAGATGCTGTGGAGGAAAAATGG - Intergenic
1044490244 8:92805177-92805199 CAGAGGCTCTGGAGGAGAACTGG - Intergenic
1044510934 8:93077681-93077703 CAGAGGCTGTGAAGGGAAGAGGG + Intergenic
1044602050 8:94015092-94015114 CAGAGGGTGTGGATGGAAAAAGG - Intergenic
1044624528 8:94223787-94223809 GAGGGGGGATGGAGGGAAAATGG + Intergenic
1044637709 8:94343002-94343024 CACAGGGTCTGGATGGAAAAAGG + Intergenic
1046069983 8:109239245-109239267 CAGAGCCTCTGGAGGGGGAATGG - Intergenic
1046544739 8:115635626-115635648 AAGGGGTTCTGGGGGTAAAAAGG + Intronic
1046715614 8:117563340-117563362 CAGGGCCTCTGGAGTAAACAAGG + Intergenic
1046768785 8:118098308-118098330 GAGGGGCCCAGGAGGGAACAAGG - Intronic
1046937242 8:119896340-119896362 CATGGCCTTTGGAGGGAAACTGG - Intronic
1047096984 8:121636440-121636462 CAGTGGGACTGGAGAGAAAAAGG - Intronic
1048063387 8:130943651-130943673 CAGGAGCTCAGGAAGGACAAGGG + Intronic
1048848405 8:138621137-138621159 CAGGGGATGTGGTTGGAAAATGG - Intronic
1049570942 8:143370020-143370042 CCTGGGCACTGGAGGGAAAGAGG + Intronic
1049744602 8:144257915-144257937 CAGGGGCTGTGGAGTTGAAATGG + Intronic
1049801368 8:144518950-144518972 CAGTGGCTCTCCAGGGAAGAGGG + Intronic
1050111324 9:2219595-2219617 CGGGGACTTTGGTGGGAAAATGG + Intergenic
1052335475 9:27315083-27315105 CAGAGGGGCTGGAGGGAAAGGGG + Intergenic
1052996953 9:34556124-34556146 CAGGCTCTCTGCGGGGAAAAGGG - Intronic
1053281181 9:36820604-36820626 CAGGGCCTCTCGGGAGAAAATGG + Intergenic
1055405591 9:75970369-75970391 AAAGTGCCCTGGAGGGAAAAAGG + Intronic
1056362248 9:85870290-85870312 CAGTGCCTCCTGAGGGAAAAAGG - Intergenic
1057277995 9:93686429-93686451 CAGGGACCCTGGAGGAGAAAAGG + Intergenic
1057836445 9:98449237-98449259 CAAGGCCTCTGGAGGAAAGACGG - Intronic
1059059023 9:111015394-111015416 CAGTGGGTTTGGAGGGAAGAAGG - Intronic
1059120181 9:111634570-111634592 CAGTGGCTCTGGAATAAAAACGG + Intronic
1059257572 9:112945306-112945328 CCTGGGCTCTGGCAGGAAAAGGG + Intergenic
1059426141 9:114222166-114222188 GAGGGGCCCTGGAGGGAGATGGG + Intronic
1060196710 9:121628678-121628700 CAGGGGCAGGGGAGGGAAAGCGG + Intronic
1060206755 9:121686819-121686841 CTGGGGCTCTGGAGGAAATGTGG - Intronic
1060206876 9:121687311-121687333 CAGGGACACTGGATGGAACAAGG + Intronic
1060213224 9:121723160-121723182 CTGTGGCTCTGGAAGGAAGAGGG + Intronic
1060721792 9:125984486-125984508 CTGGGACTCTGGAGGGAAGGAGG - Intergenic
1060778985 9:126398016-126398038 CTGGGGCTCTGGCTGGGAAAGGG - Intronic
1061715729 9:132517805-132517827 CAGGGGATGTGCAGGGGAAATGG - Intronic
1061825886 9:133257872-133257894 CAGGGGCTTTGGAGAACAAAGGG + Intronic
1062138681 9:134943764-134943786 CAGGACCTCGGGAGGGAAGAAGG - Intergenic
1062375708 9:136260916-136260938 CACAGGCTCTGGAGGGAGACAGG + Intergenic
1062551929 9:137091972-137091994 TAGGGGCTTAGGAGAGAAAATGG + Intronic
1062741837 9:138179523-138179545 CAGGGGCCCAGGAGGGAACAGGG + Intergenic
1185511302 X:666823-666845 TAGAGCCTCTGGAGGGAACATGG + Intergenic
1185859209 X:3562016-3562038 CAGGGGCTGGGGAGGGGAGAAGG - Intergenic
1186941300 X:14510488-14510510 GAGGGAATCTGGAGGGACAAAGG + Intergenic
1186961707 X:14743752-14743774 CAGAGACTTTGGAGGGAACATGG - Intergenic
1187947147 X:24437248-24437270 CAGGGGCTCTGGAGCCAGTAAGG + Intergenic
1188472170 X:30553226-30553248 CAGGGAATCTGGAAGGCAAAGGG + Intergenic
1189526177 X:41824435-41824457 GAGGGGCACTGGAGGAGAAAGGG + Intronic
1190055374 X:47178416-47178438 CAGGGGCTCGGGGAGGGAAATGG - Intronic
1190531854 X:51386442-51386464 CAGAGGCCTAGGAGGGAAAATGG - Intergenic
1190752145 X:53372016-53372038 CAGTAGGTCTGGAGGGATAAGGG - Intergenic
1193046572 X:77060667-77060689 CCAGGGATTTGGAGGGAAAAAGG - Intergenic
1193698927 X:84740642-84740664 CAGGGGCCCTGCAGGCAACAGGG + Intergenic
1193822980 X:86188935-86188957 TAGATGCTGTGGAGGGAAAATGG - Intronic
1194155763 X:90386763-90386785 CAGAAACTTTGGAGGGAAAAAGG + Intergenic
1195602179 X:106762266-106762288 CAGGGGCTGGGGAGGGTACAGGG - Intronic
1196374760 X:115020931-115020953 CAGAGGCTGGGGAGGGAATAAGG - Intergenic
1196589954 X:117475360-117475382 CAGAGGCTCTGAAGGGTAATAGG - Intergenic
1197188220 X:123612513-123612535 CAGGGGCTGAGAAGGGGAAATGG + Intronic
1197608623 X:128613676-128613698 AAAGGTCTGTGGAGGGAAAAAGG + Intergenic
1198486367 X:137091616-137091638 TATTGGCTCTGAAGGGAAAAGGG - Intergenic
1198627686 X:138596856-138596878 CTGGGGCTGTGCAGGGGAAAAGG + Intergenic
1198798883 X:140429556-140429578 CAGGGGCTGGGGAGGGTAATGGG + Intergenic
1199489747 X:148385252-148385274 CACATGCTCTGGAGGAAAAATGG - Intergenic
1199746676 X:150776112-150776134 CAAGGTCTTTGGAGGGAAAGGGG - Intronic
1199996372 X:153029101-153029123 CTGGGGCTATGCAGGGAAACTGG - Intergenic
1200012109 X:153127109-153127131 CAGGGACCCTGCAGGGAAACAGG - Intergenic
1200027491 X:153272810-153272832 CAGGGACCCTGCAGGGAAACAGG + Intergenic
1200034812 X:153320348-153320370 CTGGGGCTGTGCAGGGAAACTGG + Intergenic
1200502110 Y:3963706-3963728 CAGAAACTTTGGAGGGAAAAAGG + Intergenic
1201400476 Y:13599229-13599251 CTGAGGCTCTGGAGGGCAACAGG - Intergenic
1201758452 Y:17514724-17514746 CAGGGGCCCAGGAGGGAGCAGGG - Intergenic
1201843103 Y:18391266-18391288 CAGGGGCCCAGGAGGGAGCAGGG + Intergenic