ID: 1084524404

View in Genome Browser
Species Human (GRCh38)
Location 11:69686769-69686791
Sequence CCTTCTCCCCATGAGTTGTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1084524404_1084524412 15 Left 1084524404 11:69686769-69686791 CCACACAACTCATGGGGAGAAGG No data
Right 1084524412 11:69686807-69686829 GACAGGTTACCCGGCTCTGATGG No data
1084524404_1084524416 26 Left 1084524404 11:69686769-69686791 CCACACAACTCATGGGGAGAAGG No data
Right 1084524416 11:69686818-69686840 CGGCTCTGATGGGAAAAGCGAGG No data
1084524404_1084524409 6 Left 1084524404 11:69686769-69686791 CCACACAACTCATGGGGAGAAGG No data
Right 1084524409 11:69686798-69686820 GGGCCCAGTGACAGGTTACCCGG No data
1084524404_1084524413 16 Left 1084524404 11:69686769-69686791 CCACACAACTCATGGGGAGAAGG No data
Right 1084524413 11:69686808-69686830 ACAGGTTACCCGGCTCTGATGGG No data
1084524404_1084524408 -2 Left 1084524404 11:69686769-69686791 CCACACAACTCATGGGGAGAAGG No data
Right 1084524408 11:69686790-69686812 GGAGACATGGGCCCAGTGACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1084524404 Original CRISPR CCTTCTCCCCATGAGTTGTG TGG (reversed) Intergenic
No off target data available for this crispr