ID: 1084527014

View in Genome Browser
Species Human (GRCh38)
Location 11:69704004-69704026
Sequence GCGCTCCTGCTCTGACGGCG CGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 64
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 59}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1084527010_1084527014 -5 Left 1084527010 11:69703986-69704008 CCCTAGATCCTGGACGCAGCGCT 0: 1
1: 0
2: 0
3: 0
4: 48
Right 1084527014 11:69704004-69704026 GCGCTCCTGCTCTGACGGCGCGG 0: 1
1: 0
2: 0
3: 4
4: 59
1084527011_1084527014 -6 Left 1084527011 11:69703987-69704009 CCTAGATCCTGGACGCAGCGCTC 0: 1
1: 0
2: 0
3: 4
4: 89
Right 1084527014 11:69704004-69704026 GCGCTCCTGCTCTGACGGCGCGG 0: 1
1: 0
2: 0
3: 4
4: 59
1084527008_1084527014 15 Left 1084527008 11:69703966-69703988 CCGGGTTGGGATGGTCGTGGCCC 0: 1
1: 0
2: 1
3: 10
4: 103
Right 1084527014 11:69704004-69704026 GCGCTCCTGCTCTGACGGCGCGG 0: 1
1: 0
2: 0
3: 4
4: 59

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1084527014 Original CRISPR GCGCTCCTGCTCTGACGGCG CGG Exonic
900367673 1:2317881-2317903 GCGTCCCTGCGCTGAGGGCGCGG - Intergenic
919838500 1:201592843-201592865 TCGCTCCTGGTCTGACGGGTAGG - Intergenic
920610212 1:207428548-207428570 GTGCTCCTGCTCTGTCAGGGAGG + Intergenic
923983573 1:239353894-239353916 GAGATCCTGCTCTGAGGGCCAGG - Intergenic
1067173593 10:43926970-43926992 GCTCTCCTGCACTGAAGACGGGG + Intergenic
1067208861 10:44242141-44242163 GCTCTCCTGCACTGAAGGGGTGG - Intergenic
1071311496 10:84347761-84347783 GGGCTCCTTCTCAGACGGGGCGG + Intronic
1073363572 10:102918893-102918915 GCTGTCCGGCTCTGGCGGCGCGG - Exonic
1074080123 10:110161782-110161804 GTGCCCCTGCTCTGGCGGCTGGG - Intergenic
1076683199 10:132185859-132185881 CCGCTCCTGCCGTGACCGCGCGG + Intergenic
1078547438 11:12256476-12256498 GTGATCCTGGTCTGACGGAGTGG - Intronic
1082609702 11:55282044-55282066 GCACTCCTGGTCTGACGTTGGGG + Intergenic
1083713386 11:64562177-64562199 GCGCTCCTGCCATGGGGGCGGGG + Intronic
1084527014 11:69704004-69704026 GCGCTCCTGCTCTGACGGCGCGG + Exonic
1096491321 12:52014740-52014762 GCGCTCCTGCCTCTACGGCGCGG + Exonic
1097249927 12:57626905-57626927 TGGCTCCTGCTCCGACGTCGTGG - Exonic
1104021229 12:124993776-124993798 GCGCCCATGCTCGGCCGGCGGGG - Exonic
1113473111 13:110561062-110561084 GCGTTCCTGCTCTGCCGCCCTGG - Intronic
1124389948 15:29245940-29245962 GCACTCATGCTCTGACTGCAGGG + Intronic
1131215312 15:90530603-90530625 GCCCTGCTGTTCTGCCGGCGTGG + Intronic
1131272532 15:90955822-90955844 GCGCTCCTCCTCTGCCAGTGAGG - Intronic
1132333399 15:101027669-101027691 GCGCTGCTGCTCTGCCAGCACGG - Exonic
1132416201 15:101620831-101620853 GAACTCCTGCTCTGACTGGGGGG - Intergenic
1144724824 17:17496538-17496560 GGGCTCCTGCTCTCTGGGCGCGG + Intergenic
1146400314 17:32496126-32496148 GCGCAACTGCTCAGACGCCGAGG + Intronic
1147820447 17:43238398-43238420 GGGCTCCGGCTCTGCCGCCGGGG + Intergenic
1147822559 17:43250290-43250312 GGGCTCCGGCTCTGCCGCCGGGG + Intergenic
1147825076 17:43265085-43265107 GGGCTCCGGCTCTGCCGCCGGGG + Intergenic
1147828196 17:43282605-43282627 GGGCTCCGGCTCTGCCGCCGGGG + Intergenic
1147829306 17:43288769-43288791 GGGCTCCGGCTCTGCCGCCGGGG + Intergenic
1147830396 17:43294904-43294926 GGGCTCCGGCTCTGCCGCCGGGG + Intergenic
1151780184 17:76240364-76240386 GCGCTGCGGCTCTGGCGGCGGGG + Exonic
1162675502 19:12295176-12295198 GCCCTCCTGCTCTGAGGCCAAGG - Intergenic
1163210845 19:15839018-15839040 CCCCTCCTGCTCTGACGCCACGG - Intergenic
1164947667 19:32310077-32310099 GCGCTCCGGCTCAGACTGCAAGG - Intergenic
1165389674 19:35531238-35531260 GCTCTCCTGCTTTGATGGCCTGG - Intergenic
1166854663 19:45777585-45777607 GTGCTCCTGCTCAGAGGGAGAGG + Exonic
1167278276 19:48552031-48552053 GCCACCCTGCTCTGAGGGCGGGG - Intergenic
929788608 2:45008735-45008757 GCGCTCCATCTGGGACGGCGAGG - Exonic
934767006 2:96885319-96885341 GAGCTCCTGTTCTGAGGGCGTGG - Intronic
947827338 2:233115283-233115305 GGGCTCCTGCTCTGCCTGCATGG + Intronic
948060965 2:235043076-235043098 GCGCTCCTTCGCTGACGCCCTGG + Exonic
1168975925 20:1965911-1965933 GCGCACCTGCCCAGAGGGCGGGG + Intergenic
1176841792 21:13848417-13848439 GGGCCCCTGCTCTCACTGCGGGG + Intergenic
1178961767 21:37072776-37072798 GCGCTCCAGCTCTGCAAGCGTGG + Exonic
1180036575 21:45253377-45253399 AGGCTCCTGCTCTGACAGCTGGG + Intergenic
1180090549 21:45531651-45531673 GCGCTCCAGCTCCGAAGCCGAGG + Exonic
1185128505 22:49024810-49024832 GGGCTCGTGCTCTGGCGCCGTGG - Intergenic
954540739 3:51391657-51391679 GGGCTCCGGCGCTGGCGGCGGGG + Exonic
966201081 3:177359913-177359935 GAGCTCCGGCTCTGCCGCCGCGG - Intergenic
977359075 4:95981041-95981063 GCCCTCCTGCCCTGAAGGTGGGG - Intergenic
979899829 4:126202000-126202022 CCGCTCATCCTCTGCCGGCGTGG - Intergenic
982059098 4:151585200-151585222 GCACTCCAGCTCTGTCGGCCAGG + Intronic
997170125 5:131710592-131710614 GCGCTCCTGATCAGGCGGAGCGG + Exonic
999244709 5:150147649-150147671 GCCCTCCTGCTCTGCCGCCCAGG - Intronic
1007665204 6:43509676-43509698 GTGCGCCTGCTCTCACTGCGCGG - Exonic
1019737194 7:2656418-2656440 CGGCTTCTGCTATGACGGCGTGG + Exonic
1021959507 7:25858104-25858126 GCGCTTCTGCTCTGCCGGGAAGG + Intergenic
1033438600 7:141357466-141357488 GTGCTCCTGCTATGACAGCAAGG - Intronic
1051372242 9:16368471-16368493 GGACTCCTGCTCTGACAGCAGGG + Intergenic
1056791765 9:89630328-89630350 GCCCTCCTGCTCTGAGCGCAAGG - Intergenic
1057720590 9:97528726-97528748 CTGCTCCTGCTCTGAAGCCGTGG - Intronic
1197929311 X:131678581-131678603 GCGCTCCTGCTCTGGCAGGGAGG + Intergenic
1197946014 X:131840869-131840891 GCGCTCCTGCTCTGGCAGGGAGG - Intergenic