ID: 1084529142

View in Genome Browser
Species Human (GRCh38)
Location 11:69716941-69716963
Sequence AGGCACACAGTGGGAGCCTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1084529142_1084529150 12 Left 1084529142 11:69716941-69716963 CCACAGGCTCCCACTGTGTGCCT No data
Right 1084529150 11:69716976-69716998 TTGGCTCAGTTTCCCCACCTAGG No data
1084529142_1084529157 29 Left 1084529142 11:69716941-69716963 CCACAGGCTCCCACTGTGTGCCT No data
Right 1084529157 11:69716993-69717015 CCTAGGAAACAGGATGGACACGG No data
1084529142_1084529147 -7 Left 1084529142 11:69716941-69716963 CCACAGGCTCCCACTGTGTGCCT No data
Right 1084529147 11:69716957-69716979 TGTGCCTTGGGACAAGTCCTTGG No data
1084529142_1084529158 30 Left 1084529142 11:69716941-69716963 CCACAGGCTCCCACTGTGTGCCT No data
Right 1084529158 11:69716994-69717016 CTAGGAAACAGGATGGACACGGG No data
1084529142_1084529152 23 Left 1084529142 11:69716941-69716963 CCACAGGCTCCCACTGTGTGCCT No data
Right 1084529152 11:69716987-69717009 TCCCCACCTAGGAAACAGGATGG No data
1084529142_1084529151 19 Left 1084529142 11:69716941-69716963 CCACAGGCTCCCACTGTGTGCCT No data
Right 1084529151 11:69716983-69717005 AGTTTCCCCACCTAGGAAACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1084529142 Original CRISPR AGGCACACAGTGGGAGCCTG TGG (reversed) Intergenic