ID: 1084529145

View in Genome Browser
Species Human (GRCh38)
Location 11:69716950-69716972
Sequence CTTGTCCCAAGGCACACAGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1084529145_1084529150 3 Left 1084529145 11:69716950-69716972 CCCACTGTGTGCCTTGGGACAAG No data
Right 1084529150 11:69716976-69716998 TTGGCTCAGTTTCCCCACCTAGG No data
1084529145_1084529157 20 Left 1084529145 11:69716950-69716972 CCCACTGTGTGCCTTGGGACAAG No data
Right 1084529157 11:69716993-69717015 CCTAGGAAACAGGATGGACACGG No data
1084529145_1084529151 10 Left 1084529145 11:69716950-69716972 CCCACTGTGTGCCTTGGGACAAG No data
Right 1084529151 11:69716983-69717005 AGTTTCCCCACCTAGGAAACAGG No data
1084529145_1084529158 21 Left 1084529145 11:69716950-69716972 CCCACTGTGTGCCTTGGGACAAG No data
Right 1084529158 11:69716994-69717016 CTAGGAAACAGGATGGACACGGG No data
1084529145_1084529152 14 Left 1084529145 11:69716950-69716972 CCCACTGTGTGCCTTGGGACAAG No data
Right 1084529152 11:69716987-69717009 TCCCCACCTAGGAAACAGGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1084529145 Original CRISPR CTTGTCCCAAGGCACACAGT GGG (reversed) Intergenic