ID: 1084529148

View in Genome Browser
Species Human (GRCh38)
Location 11:69716961-69716983
Sequence TGAGCCAAGGACTTGTCCCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1084529148_1084529158 10 Left 1084529148 11:69716961-69716983 CCTTGGGACAAGTCCTTGGCTCA No data
Right 1084529158 11:69716994-69717016 CTAGGAAACAGGATGGACACGGG No data
1084529148_1084529151 -1 Left 1084529148 11:69716961-69716983 CCTTGGGACAAGTCCTTGGCTCA No data
Right 1084529151 11:69716983-69717005 AGTTTCCCCACCTAGGAAACAGG No data
1084529148_1084529160 21 Left 1084529148 11:69716961-69716983 CCTTGGGACAAGTCCTTGGCTCA No data
Right 1084529160 11:69717005-69717027 GATGGACACGGGCTTGCAGAGGG No data
1084529148_1084529157 9 Left 1084529148 11:69716961-69716983 CCTTGGGACAAGTCCTTGGCTCA No data
Right 1084529157 11:69716993-69717015 CCTAGGAAACAGGATGGACACGG No data
1084529148_1084529150 -8 Left 1084529148 11:69716961-69716983 CCTTGGGACAAGTCCTTGGCTCA No data
Right 1084529150 11:69716976-69716998 TTGGCTCAGTTTCCCCACCTAGG No data
1084529148_1084529152 3 Left 1084529148 11:69716961-69716983 CCTTGGGACAAGTCCTTGGCTCA No data
Right 1084529152 11:69716987-69717009 TCCCCACCTAGGAAACAGGATGG No data
1084529148_1084529159 20 Left 1084529148 11:69716961-69716983 CCTTGGGACAAGTCCTTGGCTCA No data
Right 1084529159 11:69717004-69717026 GGATGGACACGGGCTTGCAGAGG No data
1084529148_1084529161 24 Left 1084529148 11:69716961-69716983 CCTTGGGACAAGTCCTTGGCTCA No data
Right 1084529161 11:69717008-69717030 GGACACGGGCTTGCAGAGGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1084529148 Original CRISPR TGAGCCAAGGACTTGTCCCA AGG (reversed) Intergenic
No off target data available for this crispr