ID: 1084529149

View in Genome Browser
Species Human (GRCh38)
Location 11:69716974-69716996
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1084529149_1084529161 11 Left 1084529149 11:69716974-69716996 CCTTGGCTCAGTTTCCCCACCTA No data
Right 1084529161 11:69717008-69717030 GGACACGGGCTTGCAGAGGGTGG No data
1084529149_1084529160 8 Left 1084529149 11:69716974-69716996 CCTTGGCTCAGTTTCCCCACCTA No data
Right 1084529160 11:69717005-69717027 GATGGACACGGGCTTGCAGAGGG No data
1084529149_1084529152 -10 Left 1084529149 11:69716974-69716996 CCTTGGCTCAGTTTCCCCACCTA No data
Right 1084529152 11:69716987-69717009 TCCCCACCTAGGAAACAGGATGG No data
1084529149_1084529162 18 Left 1084529149 11:69716974-69716996 CCTTGGCTCAGTTTCCCCACCTA No data
Right 1084529162 11:69717015-69717037 GGCTTGCAGAGGGTGGCCAGAGG No data
1084529149_1084529157 -4 Left 1084529149 11:69716974-69716996 CCTTGGCTCAGTTTCCCCACCTA No data
Right 1084529157 11:69716993-69717015 CCTAGGAAACAGGATGGACACGG No data
1084529149_1084529164 26 Left 1084529149 11:69716974-69716996 CCTTGGCTCAGTTTCCCCACCTA No data
Right 1084529164 11:69717023-69717045 GAGGGTGGCCAGAGGGAGCCAGG No data
1084529149_1084529158 -3 Left 1084529149 11:69716974-69716996 CCTTGGCTCAGTTTCCCCACCTA No data
Right 1084529158 11:69716994-69717016 CTAGGAAACAGGATGGACACGGG No data
1084529149_1084529159 7 Left 1084529149 11:69716974-69716996 CCTTGGCTCAGTTTCCCCACCTA No data
Right 1084529159 11:69717004-69717026 GGATGGACACGGGCTTGCAGAGG No data
1084529149_1084529163 19 Left 1084529149 11:69716974-69716996 CCTTGGCTCAGTTTCCCCACCTA No data
Right 1084529163 11:69717016-69717038 GCTTGCAGAGGGTGGCCAGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1084529149 Original CRISPR TAGGTGGGGAAACTGAGCCA AGG (reversed) Intergenic