ID: 1084529152

View in Genome Browser
Species Human (GRCh38)
Location 11:69716987-69717009
Sequence TCCCCACCTAGGAAACAGGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1084529142_1084529152 23 Left 1084529142 11:69716941-69716963 CCACAGGCTCCCACTGTGTGCCT No data
Right 1084529152 11:69716987-69717009 TCCCCACCTAGGAAACAGGATGG No data
1084529146_1084529152 13 Left 1084529146 11:69716951-69716973 CCACTGTGTGCCTTGGGACAAGT No data
Right 1084529152 11:69716987-69717009 TCCCCACCTAGGAAACAGGATGG No data
1084529148_1084529152 3 Left 1084529148 11:69716961-69716983 CCTTGGGACAAGTCCTTGGCTCA No data
Right 1084529152 11:69716987-69717009 TCCCCACCTAGGAAACAGGATGG No data
1084529149_1084529152 -10 Left 1084529149 11:69716974-69716996 CCTTGGCTCAGTTTCCCCACCTA No data
Right 1084529152 11:69716987-69717009 TCCCCACCTAGGAAACAGGATGG No data
1084529145_1084529152 14 Left 1084529145 11:69716950-69716972 CCCACTGTGTGCCTTGGGACAAG No data
Right 1084529152 11:69716987-69717009 TCCCCACCTAGGAAACAGGATGG No data
1084529141_1084529152 27 Left 1084529141 11:69716937-69716959 CCTGCCACAGGCTCCCACTGTGT No data
Right 1084529152 11:69716987-69717009 TCCCCACCTAGGAAACAGGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1084529152 Original CRISPR TCCCCACCTAGGAAACAGGA TGG Intergenic