ID: 1084529153

View in Genome Browser
Species Human (GRCh38)
Location 11:69716988-69717010
Sequence TCCATCCTGTTTCCTAGGTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1084529153_1084529164 12 Left 1084529153 11:69716988-69717010 CCCCACCTAGGAAACAGGATGGA No data
Right 1084529164 11:69717023-69717045 GAGGGTGGCCAGAGGGAGCCAGG No data
1084529153_1084529159 -7 Left 1084529153 11:69716988-69717010 CCCCACCTAGGAAACAGGATGGA No data
Right 1084529159 11:69717004-69717026 GGATGGACACGGGCTTGCAGAGG No data
1084529153_1084529166 20 Left 1084529153 11:69716988-69717010 CCCCACCTAGGAAACAGGATGGA No data
Right 1084529166 11:69717031-69717053 CCAGAGGGAGCCAGGCCAAGCGG No data
1084529153_1084529160 -6 Left 1084529153 11:69716988-69717010 CCCCACCTAGGAAACAGGATGGA No data
Right 1084529160 11:69717005-69717027 GATGGACACGGGCTTGCAGAGGG No data
1084529153_1084529161 -3 Left 1084529153 11:69716988-69717010 CCCCACCTAGGAAACAGGATGGA No data
Right 1084529161 11:69717008-69717030 GGACACGGGCTTGCAGAGGGTGG No data
1084529153_1084529163 5 Left 1084529153 11:69716988-69717010 CCCCACCTAGGAAACAGGATGGA No data
Right 1084529163 11:69717016-69717038 GCTTGCAGAGGGTGGCCAGAGGG No data
1084529153_1084529162 4 Left 1084529153 11:69716988-69717010 CCCCACCTAGGAAACAGGATGGA No data
Right 1084529162 11:69717015-69717037 GGCTTGCAGAGGGTGGCCAGAGG No data
1084529153_1084529168 25 Left 1084529153 11:69716988-69717010 CCCCACCTAGGAAACAGGATGGA No data
Right 1084529168 11:69717036-69717058 GGGAGCCAGGCCAAGCGGCTGGG No data
1084529153_1084529167 24 Left 1084529153 11:69716988-69717010 CCCCACCTAGGAAACAGGATGGA No data
Right 1084529167 11:69717035-69717057 AGGGAGCCAGGCCAAGCGGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1084529153 Original CRISPR TCCATCCTGTTTCCTAGGTG GGG (reversed) Intergenic