ID: 1084529154

View in Genome Browser
Species Human (GRCh38)
Location 11:69716989-69717011
Sequence GTCCATCCTGTTTCCTAGGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1084529154_1084529164 11 Left 1084529154 11:69716989-69717011 CCCACCTAGGAAACAGGATGGAC No data
Right 1084529164 11:69717023-69717045 GAGGGTGGCCAGAGGGAGCCAGG No data
1084529154_1084529162 3 Left 1084529154 11:69716989-69717011 CCCACCTAGGAAACAGGATGGAC No data
Right 1084529162 11:69717015-69717037 GGCTTGCAGAGGGTGGCCAGAGG No data
1084529154_1084529160 -7 Left 1084529154 11:69716989-69717011 CCCACCTAGGAAACAGGATGGAC No data
Right 1084529160 11:69717005-69717027 GATGGACACGGGCTTGCAGAGGG No data
1084529154_1084529163 4 Left 1084529154 11:69716989-69717011 CCCACCTAGGAAACAGGATGGAC No data
Right 1084529163 11:69717016-69717038 GCTTGCAGAGGGTGGCCAGAGGG No data
1084529154_1084529161 -4 Left 1084529154 11:69716989-69717011 CCCACCTAGGAAACAGGATGGAC No data
Right 1084529161 11:69717008-69717030 GGACACGGGCTTGCAGAGGGTGG No data
1084529154_1084529168 24 Left 1084529154 11:69716989-69717011 CCCACCTAGGAAACAGGATGGAC No data
Right 1084529168 11:69717036-69717058 GGGAGCCAGGCCAAGCGGCTGGG No data
1084529154_1084529170 30 Left 1084529154 11:69716989-69717011 CCCACCTAGGAAACAGGATGGAC No data
Right 1084529170 11:69717042-69717064 CAGGCCAAGCGGCTGGGATGTGG No data
1084529154_1084529167 23 Left 1084529154 11:69716989-69717011 CCCACCTAGGAAACAGGATGGAC No data
Right 1084529167 11:69717035-69717057 AGGGAGCCAGGCCAAGCGGCTGG No data
1084529154_1084529166 19 Left 1084529154 11:69716989-69717011 CCCACCTAGGAAACAGGATGGAC No data
Right 1084529166 11:69717031-69717053 CCAGAGGGAGCCAGGCCAAGCGG No data
1084529154_1084529159 -8 Left 1084529154 11:69716989-69717011 CCCACCTAGGAAACAGGATGGAC No data
Right 1084529159 11:69717004-69717026 GGATGGACACGGGCTTGCAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1084529154 Original CRISPR GTCCATCCTGTTTCCTAGGT GGG (reversed) Intergenic
No off target data available for this crispr