ID: 1084529155

View in Genome Browser
Species Human (GRCh38)
Location 11:69716990-69717012
Sequence TGTCCATCCTGTTTCCTAGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1084529155_1084529168 23 Left 1084529155 11:69716990-69717012 CCACCTAGGAAACAGGATGGACA No data
Right 1084529168 11:69717036-69717058 GGGAGCCAGGCCAAGCGGCTGGG No data
1084529155_1084529171 30 Left 1084529155 11:69716990-69717012 CCACCTAGGAAACAGGATGGACA No data
Right 1084529171 11:69717043-69717065 AGGCCAAGCGGCTGGGATGTGGG No data
1084529155_1084529162 2 Left 1084529155 11:69716990-69717012 CCACCTAGGAAACAGGATGGACA No data
Right 1084529162 11:69717015-69717037 GGCTTGCAGAGGGTGGCCAGAGG No data
1084529155_1084529160 -8 Left 1084529155 11:69716990-69717012 CCACCTAGGAAACAGGATGGACA No data
Right 1084529160 11:69717005-69717027 GATGGACACGGGCTTGCAGAGGG No data
1084529155_1084529166 18 Left 1084529155 11:69716990-69717012 CCACCTAGGAAACAGGATGGACA No data
Right 1084529166 11:69717031-69717053 CCAGAGGGAGCCAGGCCAAGCGG No data
1084529155_1084529161 -5 Left 1084529155 11:69716990-69717012 CCACCTAGGAAACAGGATGGACA No data
Right 1084529161 11:69717008-69717030 GGACACGGGCTTGCAGAGGGTGG No data
1084529155_1084529159 -9 Left 1084529155 11:69716990-69717012 CCACCTAGGAAACAGGATGGACA No data
Right 1084529159 11:69717004-69717026 GGATGGACACGGGCTTGCAGAGG No data
1084529155_1084529167 22 Left 1084529155 11:69716990-69717012 CCACCTAGGAAACAGGATGGACA No data
Right 1084529167 11:69717035-69717057 AGGGAGCCAGGCCAAGCGGCTGG No data
1084529155_1084529163 3 Left 1084529155 11:69716990-69717012 CCACCTAGGAAACAGGATGGACA No data
Right 1084529163 11:69717016-69717038 GCTTGCAGAGGGTGGCCAGAGGG No data
1084529155_1084529170 29 Left 1084529155 11:69716990-69717012 CCACCTAGGAAACAGGATGGACA No data
Right 1084529170 11:69717042-69717064 CAGGCCAAGCGGCTGGGATGTGG No data
1084529155_1084529164 10 Left 1084529155 11:69716990-69717012 CCACCTAGGAAACAGGATGGACA No data
Right 1084529164 11:69717023-69717045 GAGGGTGGCCAGAGGGAGCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1084529155 Original CRISPR TGTCCATCCTGTTTCCTAGG TGG (reversed) Intergenic