ID: 1084529156

View in Genome Browser
Species Human (GRCh38)
Location 11:69716993-69717015
Sequence CCGTGTCCATCCTGTTTCCT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 12 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1084529156_1084529162 -1 Left 1084529156 11:69716993-69717015 CCTAGGAAACAGGATGGACACGG No data
Right 1084529162 11:69717015-69717037 GGCTTGCAGAGGGTGGCCAGAGG No data
1084529156_1084529161 -8 Left 1084529156 11:69716993-69717015 CCTAGGAAACAGGATGGACACGG No data
Right 1084529161 11:69717008-69717030 GGACACGGGCTTGCAGAGGGTGG No data
1084529156_1084529175 30 Left 1084529156 11:69716993-69717015 CCTAGGAAACAGGATGGACACGG No data
Right 1084529175 11:69717046-69717068 CCAAGCGGCTGGGATGTGGGGGG No data
1084529156_1084529164 7 Left 1084529156 11:69716993-69717015 CCTAGGAAACAGGATGGACACGG No data
Right 1084529164 11:69717023-69717045 GAGGGTGGCCAGAGGGAGCCAGG No data
1084529156_1084529170 26 Left 1084529156 11:69716993-69717015 CCTAGGAAACAGGATGGACACGG No data
Right 1084529170 11:69717042-69717064 CAGGCCAAGCGGCTGGGATGTGG No data
1084529156_1084529163 0 Left 1084529156 11:69716993-69717015 CCTAGGAAACAGGATGGACACGG No data
Right 1084529163 11:69717016-69717038 GCTTGCAGAGGGTGGCCAGAGGG No data
1084529156_1084529167 19 Left 1084529156 11:69716993-69717015 CCTAGGAAACAGGATGGACACGG No data
Right 1084529167 11:69717035-69717057 AGGGAGCCAGGCCAAGCGGCTGG No data
1084529156_1084529168 20 Left 1084529156 11:69716993-69717015 CCTAGGAAACAGGATGGACACGG No data
Right 1084529168 11:69717036-69717058 GGGAGCCAGGCCAAGCGGCTGGG No data
1084529156_1084529172 28 Left 1084529156 11:69716993-69717015 CCTAGGAAACAGGATGGACACGG No data
Right 1084529172 11:69717044-69717066 GGCCAAGCGGCTGGGATGTGGGG No data
1084529156_1084529166 15 Left 1084529156 11:69716993-69717015 CCTAGGAAACAGGATGGACACGG No data
Right 1084529166 11:69717031-69717053 CCAGAGGGAGCCAGGCCAAGCGG No data
1084529156_1084529171 27 Left 1084529156 11:69716993-69717015 CCTAGGAAACAGGATGGACACGG No data
Right 1084529171 11:69717043-69717065 AGGCCAAGCGGCTGGGATGTGGG No data
1084529156_1084529173 29 Left 1084529156 11:69716993-69717015 CCTAGGAAACAGGATGGACACGG No data
Right 1084529173 11:69717045-69717067 GCCAAGCGGCTGGGATGTGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1084529156 Original CRISPR CCGTGTCCATCCTGTTTCCT AGG (reversed) Intergenic