ID: 1084529158

View in Genome Browser
Species Human (GRCh38)
Location 11:69716994-69717016
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1084529142_1084529158 30 Left 1084529142 11:69716941-69716963 CCACAGGCTCCCACTGTGTGCCT No data
Right 1084529158 11:69716994-69717016 CTAGGAAACAGGATGGACACGGG No data
1084529149_1084529158 -3 Left 1084529149 11:69716974-69716996 CCTTGGCTCAGTTTCCCCACCTA No data
Right 1084529158 11:69716994-69717016 CTAGGAAACAGGATGGACACGGG No data
1084529148_1084529158 10 Left 1084529148 11:69716961-69716983 CCTTGGGACAAGTCCTTGGCTCA No data
Right 1084529158 11:69716994-69717016 CTAGGAAACAGGATGGACACGGG No data
1084529145_1084529158 21 Left 1084529145 11:69716950-69716972 CCCACTGTGTGCCTTGGGACAAG No data
Right 1084529158 11:69716994-69717016 CTAGGAAACAGGATGGACACGGG No data
1084529146_1084529158 20 Left 1084529146 11:69716951-69716973 CCACTGTGTGCCTTGGGACAAGT No data
Right 1084529158 11:69716994-69717016 CTAGGAAACAGGATGGACACGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1084529158 Original CRISPR CTAGGAAACAGGATGGACAC GGG Intergenic