ID: 1084529160

View in Genome Browser
Species Human (GRCh38)
Location 11:69717005-69717027
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1084529155_1084529160 -8 Left 1084529155 11:69716990-69717012 CCACCTAGGAAACAGGATGGACA No data
Right 1084529160 11:69717005-69717027 GATGGACACGGGCTTGCAGAGGG No data
1084529153_1084529160 -6 Left 1084529153 11:69716988-69717010 CCCCACCTAGGAAACAGGATGGA No data
Right 1084529160 11:69717005-69717027 GATGGACACGGGCTTGCAGAGGG No data
1084529149_1084529160 8 Left 1084529149 11:69716974-69716996 CCTTGGCTCAGTTTCCCCACCTA No data
Right 1084529160 11:69717005-69717027 GATGGACACGGGCTTGCAGAGGG No data
1084529148_1084529160 21 Left 1084529148 11:69716961-69716983 CCTTGGGACAAGTCCTTGGCTCA No data
Right 1084529160 11:69717005-69717027 GATGGACACGGGCTTGCAGAGGG No data
1084529154_1084529160 -7 Left 1084529154 11:69716989-69717011 CCCACCTAGGAAACAGGATGGAC No data
Right 1084529160 11:69717005-69717027 GATGGACACGGGCTTGCAGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1084529160 Original CRISPR GATGGACACGGGCTTGCAGA GGG Intergenic