ID: 1084529166

View in Genome Browser
Species Human (GRCh38)
Location 11:69717031-69717053
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1084529155_1084529166 18 Left 1084529155 11:69716990-69717012 CCACCTAGGAAACAGGATGGACA No data
Right 1084529166 11:69717031-69717053 CCAGAGGGAGCCAGGCCAAGCGG No data
1084529154_1084529166 19 Left 1084529154 11:69716989-69717011 CCCACCTAGGAAACAGGATGGAC No data
Right 1084529166 11:69717031-69717053 CCAGAGGGAGCCAGGCCAAGCGG No data
1084529153_1084529166 20 Left 1084529153 11:69716988-69717010 CCCCACCTAGGAAACAGGATGGA No data
Right 1084529166 11:69717031-69717053 CCAGAGGGAGCCAGGCCAAGCGG No data
1084529156_1084529166 15 Left 1084529156 11:69716993-69717015 CCTAGGAAACAGGATGGACACGG No data
Right 1084529166 11:69717031-69717053 CCAGAGGGAGCCAGGCCAAGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1084529166 Original CRISPR CCAGAGGGAGCCAGGCCAAG CGG Intergenic