ID: 1084529556

View in Genome Browser
Species Human (GRCh38)
Location 11:69718894-69718916
Sequence CAGTGTCCCCGAGGTGAACT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1084529547_1084529556 10 Left 1084529547 11:69718861-69718883 CCCCAGAGAGGGGGAGTGGGCAG No data
Right 1084529556 11:69718894-69718916 CAGTGTCCCCGAGGTGAACTTGG No data
1084529537_1084529556 29 Left 1084529537 11:69718842-69718864 CCCCAGGAGCTCCTCTGCTCCCC No data
Right 1084529556 11:69718894-69718916 CAGTGTCCCCGAGGTGAACTTGG No data
1084529538_1084529556 28 Left 1084529538 11:69718843-69718865 CCCAGGAGCTCCTCTGCTCCCCA No data
Right 1084529556 11:69718894-69718916 CAGTGTCCCCGAGGTGAACTTGG No data
1084529548_1084529556 9 Left 1084529548 11:69718862-69718884 CCCAGAGAGGGGGAGTGGGCAGT No data
Right 1084529556 11:69718894-69718916 CAGTGTCCCCGAGGTGAACTTGG No data
1084529539_1084529556 27 Left 1084529539 11:69718844-69718866 CCAGGAGCTCCTCTGCTCCCCAG No data
Right 1084529556 11:69718894-69718916 CAGTGTCCCCGAGGTGAACTTGG No data
1084529544_1084529556 18 Left 1084529544 11:69718853-69718875 CCTCTGCTCCCCAGAGAGGGGGA No data
Right 1084529556 11:69718894-69718916 CAGTGTCCCCGAGGTGAACTTGG No data
1084529549_1084529556 8 Left 1084529549 11:69718863-69718885 CCAGAGAGGGGGAGTGGGCAGTG No data
Right 1084529556 11:69718894-69718916 CAGTGTCCCCGAGGTGAACTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1084529556 Original CRISPR CAGTGTCCCCGAGGTGAACT TGG Intergenic
No off target data available for this crispr