ID: 1084530266

View in Genome Browser
Species Human (GRCh38)
Location 11:69723169-69723191
Sequence GGGTGAACTGCACTGGGTGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1084530260_1084530266 2 Left 1084530260 11:69723144-69723166 CCAGCACGCCAGGGAGAGGGGCT No data
Right 1084530266 11:69723169-69723191 GGGTGAACTGCACTGGGTGCAGG No data
1084530253_1084530266 12 Left 1084530253 11:69723134-69723156 CCTGGCTAGCCCAGCACGCCAGG No data
Right 1084530266 11:69723169-69723191 GGGTGAACTGCACTGGGTGCAGG No data
1084530263_1084530266 -6 Left 1084530263 11:69723152-69723174 CCAGGGAGAGGGGCTCAGGGTGA No data
Right 1084530266 11:69723169-69723191 GGGTGAACTGCACTGGGTGCAGG No data
1084530259_1084530266 3 Left 1084530259 11:69723143-69723165 CCCAGCACGCCAGGGAGAGGGGC No data
Right 1084530266 11:69723169-69723191 GGGTGAACTGCACTGGGTGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1084530266 Original CRISPR GGGTGAACTGCACTGGGTGC AGG Intergenic
No off target data available for this crispr