ID: 1084530618

View in Genome Browser
Species Human (GRCh38)
Location 11:69725714-69725736
Sequence CACTTCAATCCAGGAGGCGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 142759
Summary {0: 3, 1: 512, 2: 9337, 3: 41491, 4: 91416}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1084530609_1084530618 17 Left 1084530609 11:69725674-69725696 CCTGTAATCCCAGCTGCTCAGGA 0: 1343
1: 58442
2: 147947
3: 235858
4: 223332
Right 1084530618 11:69725714-69725736 CACTTCAATCCAGGAGGCGGAGG 0: 3
1: 512
2: 9337
3: 41491
4: 91416
1084530613_1084530618 8 Left 1084530613 11:69725683-69725705 CCAGCTGCTCAGGAGGCTGAGGC 0: 2413
1: 91916
2: 198280
3: 230926
4: 160716
Right 1084530618 11:69725714-69725736 CACTTCAATCCAGGAGGCGGAGG 0: 3
1: 512
2: 9337
3: 41491
4: 91416
1084530611_1084530618 9 Left 1084530611 11:69725682-69725704 CCCAGCTGCTCAGGAGGCTGAGG 0: 2915
1: 104799
2: 210525
3: 240858
4: 156985
Right 1084530618 11:69725714-69725736 CACTTCAATCCAGGAGGCGGAGG 0: 3
1: 512
2: 9337
3: 41491
4: 91416

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1084530618 Original CRISPR CACTTCAATCCAGGAGGCGG AGG Intergenic
Too many off-targets to display for this crispr