ID: 1084535211

View in Genome Browser
Species Human (GRCh38)
Location 11:69752448-69752470
Sequence GTTAAAGAGATTTGGGAGGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1084535207_1084535211 -6 Left 1084535207 11:69752431-69752453 CCTGAGGAGGGTTTAGGGTTAAA No data
Right 1084535211 11:69752448-69752470 GTTAAAGAGATTTGGGAGGCTGG No data
1084535201_1084535211 15 Left 1084535201 11:69752410-69752432 CCTGTCACTGGAGAGAAGGAGCC No data
Right 1084535211 11:69752448-69752470 GTTAAAGAGATTTGGGAGGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1084535211 Original CRISPR GTTAAAGAGATTTGGGAGGC TGG Intergenic