ID: 1084536129

View in Genome Browser
Species Human (GRCh38)
Location 11:69758315-69758337
Sequence CCCAGGCAGCTGAGGGTCCT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1084536120_1084536129 6 Left 1084536120 11:69758286-69758308 CCATCACACTTTGGCCTGGGCCT No data
Right 1084536129 11:69758315-69758337 CCCAGGCAGCTGAGGGTCCTTGG No data
1084536122_1084536129 -8 Left 1084536122 11:69758300-69758322 CCTGGGCCTTCCTTCCCCAGGCA No data
Right 1084536129 11:69758315-69758337 CCCAGGCAGCTGAGGGTCCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1084536129 Original CRISPR CCCAGGCAGCTGAGGGTCCT TGG Intergenic
No off target data available for this crispr