ID: 1084536821

View in Genome Browser
Species Human (GRCh38)
Location 11:69762291-69762313
Sequence TGGGTCACTGACTGGATGGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1084536815_1084536821 4 Left 1084536815 11:69762264-69762286 CCAACCGGATGTGGCTGCTACGT No data
Right 1084536821 11:69762291-69762313 TGGGTCACTGACTGGATGGCTGG No data
1084536816_1084536821 0 Left 1084536816 11:69762268-69762290 CCGGATGTGGCTGCTACGTGTGC No data
Right 1084536821 11:69762291-69762313 TGGGTCACTGACTGGATGGCTGG No data
1084536813_1084536821 12 Left 1084536813 11:69762256-69762278 CCCATCGGCCAACCGGATGTGGC No data
Right 1084536821 11:69762291-69762313 TGGGTCACTGACTGGATGGCTGG No data
1084536809_1084536821 29 Left 1084536809 11:69762239-69762261 CCGGTGTTGTTCTGCTTCCCATC No data
Right 1084536821 11:69762291-69762313 TGGGTCACTGACTGGATGGCTGG No data
1084536814_1084536821 11 Left 1084536814 11:69762257-69762279 CCATCGGCCAACCGGATGTGGCT No data
Right 1084536821 11:69762291-69762313 TGGGTCACTGACTGGATGGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1084536821 Original CRISPR TGGGTCACTGACTGGATGGC TGG Intergenic
No off target data available for this crispr