ID: 1084537060

View in Genome Browser
Species Human (GRCh38)
Location 11:69763536-69763558
Sequence TTGCAGTTCTGGAGGGCAGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1084537060_1084537066 17 Left 1084537060 11:69763536-69763558 CCTTCTGCCCTCCAGAACTGCAA No data
Right 1084537066 11:69763576-69763598 GTTTAAGGCTGCCTGGTTTGTGG No data
1084537060_1084537064 2 Left 1084537060 11:69763536-69763558 CCTTCTGCCCTCCAGAACTGCAA No data
Right 1084537064 11:69763561-69763583 CAATACATTTCTGTTGTTTAAGG No data
1084537060_1084537065 10 Left 1084537060 11:69763536-69763558 CCTTCTGCCCTCCAGAACTGCAA No data
Right 1084537065 11:69763569-69763591 TTCTGTTGTTTAAGGCTGCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1084537060 Original CRISPR TTGCAGTTCTGGAGGGCAGA AGG (reversed) Intergenic
No off target data available for this crispr