ID: 1084537331

View in Genome Browser
Species Human (GRCh38)
Location 11:69764787-69764809
Sequence TGTAATGAATCAAACTGCCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1084537331_1084537339 22 Left 1084537331 11:69764787-69764809 CCTGGGCAGTTTGATTCATTACA No data
Right 1084537339 11:69764832-69764854 GATCCAGGACCCCTCCTACATGG No data
1084537331_1084537338 7 Left 1084537331 11:69764787-69764809 CCTGGGCAGTTTGATTCATTACA No data
Right 1084537338 11:69764817-69764839 CAGTTCTTCTAGCTCGATCCAGG No data
1084537331_1084537343 30 Left 1084537331 11:69764787-69764809 CCTGGGCAGTTTGATTCATTACA No data
Right 1084537343 11:69764840-69764862 ACCCCTCCTACATGGGGTCCTGG No data
1084537331_1084537340 23 Left 1084537331 11:69764787-69764809 CCTGGGCAGTTTGATTCATTACA No data
Right 1084537340 11:69764833-69764855 ATCCAGGACCCCTCCTACATGGG No data
1084537331_1084537341 24 Left 1084537331 11:69764787-69764809 CCTGGGCAGTTTGATTCATTACA No data
Right 1084537341 11:69764834-69764856 TCCAGGACCCCTCCTACATGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1084537331 Original CRISPR TGTAATGAATCAAACTGCCC AGG (reversed) Intergenic