ID: 1084537336

View in Genome Browser
Species Human (GRCh38)
Location 11:69764815-69764837
Sequence TGGATCGAGCTAGAAGAACT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 13 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1084537336_1084537347 4 Left 1084537336 11:69764815-69764837 CCCAGTTCTTCTAGCTCGATCCA No data
Right 1084537347 11:69764842-69764864 CCCTCCTACATGGGGTCCTGGGG No data
1084537336_1084537352 9 Left 1084537336 11:69764815-69764837 CCCAGTTCTTCTAGCTCGATCCA No data
Right 1084537352 11:69764847-69764869 CTACATGGGGTCCTGGGGGAGGG No data
1084537336_1084537357 24 Left 1084537336 11:69764815-69764837 CCCAGTTCTTCTAGCTCGATCCA No data
Right 1084537357 11:69764862-69764884 GGGGAGGGTGGGTCTGTGCTGGG No data
1084537336_1084537340 -5 Left 1084537336 11:69764815-69764837 CCCAGTTCTTCTAGCTCGATCCA No data
Right 1084537340 11:69764833-69764855 ATCCAGGACCCCTCCTACATGGG No data
1084537336_1084537353 12 Left 1084537336 11:69764815-69764837 CCCAGTTCTTCTAGCTCGATCCA No data
Right 1084537353 11:69764850-69764872 CATGGGGTCCTGGGGGAGGGTGG No data
1084537336_1084537339 -6 Left 1084537336 11:69764815-69764837 CCCAGTTCTTCTAGCTCGATCCA No data
Right 1084537339 11:69764832-69764854 GATCCAGGACCCCTCCTACATGG No data
1084537336_1084537345 3 Left 1084537336 11:69764815-69764837 CCCAGTTCTTCTAGCTCGATCCA No data
Right 1084537345 11:69764841-69764863 CCCCTCCTACATGGGGTCCTGGG No data
1084537336_1084537349 5 Left 1084537336 11:69764815-69764837 CCCAGTTCTTCTAGCTCGATCCA No data
Right 1084537349 11:69764843-69764865 CCTCCTACATGGGGTCCTGGGGG No data
1084537336_1084537356 23 Left 1084537336 11:69764815-69764837 CCCAGTTCTTCTAGCTCGATCCA No data
Right 1084537356 11:69764861-69764883 GGGGGAGGGTGGGTCTGTGCTGG No data
1084537336_1084537354 13 Left 1084537336 11:69764815-69764837 CCCAGTTCTTCTAGCTCGATCCA No data
Right 1084537354 11:69764851-69764873 ATGGGGTCCTGGGGGAGGGTGGG No data
1084537336_1084537341 -4 Left 1084537336 11:69764815-69764837 CCCAGTTCTTCTAGCTCGATCCA No data
Right 1084537341 11:69764834-69764856 TCCAGGACCCCTCCTACATGGGG No data
1084537336_1084537351 8 Left 1084537336 11:69764815-69764837 CCCAGTTCTTCTAGCTCGATCCA No data
Right 1084537351 11:69764846-69764868 CCTACATGGGGTCCTGGGGGAGG No data
1084537336_1084537343 2 Left 1084537336 11:69764815-69764837 CCCAGTTCTTCTAGCTCGATCCA No data
Right 1084537343 11:69764840-69764862 ACCCCTCCTACATGGGGTCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1084537336 Original CRISPR TGGATCGAGCTAGAAGAACT GGG (reversed) Intergenic
No off target data available for this crispr