ID: 1084537342

View in Genome Browser
Species Human (GRCh38)
Location 11:69764835-69764857
Sequence ACCCCATGTAGGAGGGGTCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1084537342_1084537357 4 Left 1084537342 11:69764835-69764857 CCAGGACCCCTCCTACATGGGGT No data
Right 1084537357 11:69764862-69764884 GGGGAGGGTGGGTCTGTGCTGGG No data
1084537342_1084537354 -7 Left 1084537342 11:69764835-69764857 CCAGGACCCCTCCTACATGGGGT No data
Right 1084537354 11:69764851-69764873 ATGGGGTCCTGGGGGAGGGTGGG No data
1084537342_1084537353 -8 Left 1084537342 11:69764835-69764857 CCAGGACCCCTCCTACATGGGGT No data
Right 1084537353 11:69764850-69764872 CATGGGGTCCTGGGGGAGGGTGG No data
1084537342_1084537358 30 Left 1084537342 11:69764835-69764857 CCAGGACCCCTCCTACATGGGGT No data
Right 1084537358 11:69764888-69764910 CTGTCCCCCTTCCCCACCACAGG No data
1084537342_1084537356 3 Left 1084537342 11:69764835-69764857 CCAGGACCCCTCCTACATGGGGT No data
Right 1084537356 11:69764861-69764883 GGGGGAGGGTGGGTCTGTGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1084537342 Original CRISPR ACCCCATGTAGGAGGGGTCC TGG (reversed) Intergenic