ID: 1084537344

View in Genome Browser
Species Human (GRCh38)
Location 11:69764841-69764863
Sequence CCCAGGACCCCATGTAGGAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1084537344_1084537356 -3 Left 1084537344 11:69764841-69764863 CCCCTCCTACATGGGGTCCTGGG No data
Right 1084537356 11:69764861-69764883 GGGGGAGGGTGGGTCTGTGCTGG No data
1084537344_1084537357 -2 Left 1084537344 11:69764841-69764863 CCCCTCCTACATGGGGTCCTGGG No data
Right 1084537357 11:69764862-69764884 GGGGAGGGTGGGTCTGTGCTGGG No data
1084537344_1084537362 30 Left 1084537344 11:69764841-69764863 CCCCTCCTACATGGGGTCCTGGG No data
Right 1084537362 11:69764894-69764916 CCCTTCCCCACCACAGGACATGG No data
1084537344_1084537358 24 Left 1084537344 11:69764841-69764863 CCCCTCCTACATGGGGTCCTGGG No data
Right 1084537358 11:69764888-69764910 CTGTCCCCCTTCCCCACCACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1084537344 Original CRISPR CCCAGGACCCCATGTAGGAG GGG (reversed) Intergenic