ID: 1084537348

View in Genome Browser
Species Human (GRCh38)
Location 11:69764843-69764865
Sequence CCCCCAGGACCCCATGTAGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1084537348_1084537356 -5 Left 1084537348 11:69764843-69764865 CCTCCTACATGGGGTCCTGGGGG No data
Right 1084537356 11:69764861-69764883 GGGGGAGGGTGGGTCTGTGCTGG No data
1084537348_1084537357 -4 Left 1084537348 11:69764843-69764865 CCTCCTACATGGGGTCCTGGGGG No data
Right 1084537357 11:69764862-69764884 GGGGAGGGTGGGTCTGTGCTGGG No data
1084537348_1084537358 22 Left 1084537348 11:69764843-69764865 CCTCCTACATGGGGTCCTGGGGG No data
Right 1084537358 11:69764888-69764910 CTGTCCCCCTTCCCCACCACAGG No data
1084537348_1084537362 28 Left 1084537348 11:69764843-69764865 CCTCCTACATGGGGTCCTGGGGG No data
Right 1084537362 11:69764894-69764916 CCCTTCCCCACCACAGGACATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1084537348 Original CRISPR CCCCCAGGACCCCATGTAGG AGG (reversed) Intergenic