ID: 1084537349

View in Genome Browser
Species Human (GRCh38)
Location 11:69764843-69764865
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1084537336_1084537349 5 Left 1084537336 11:69764815-69764837 CCCAGTTCTTCTAGCTCGATCCA No data
Right 1084537349 11:69764843-69764865 CCTCCTACATGGGGTCCTGGGGG No data
1084537335_1084537349 6 Left 1084537335 11:69764814-69764836 CCCCAGTTCTTCTAGCTCGATCC No data
Right 1084537349 11:69764843-69764865 CCTCCTACATGGGGTCCTGGGGG No data
1084537337_1084537349 4 Left 1084537337 11:69764816-69764838 CCAGTTCTTCTAGCTCGATCCAG No data
Right 1084537349 11:69764843-69764865 CCTCCTACATGGGGTCCTGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1084537349 Original CRISPR CCTCCTACATGGGGTCCTGG GGG Intergenic