ID: 1084537351

View in Genome Browser
Species Human (GRCh38)
Location 11:69764846-69764868
Sequence CCTACATGGGGTCCTGGGGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1084537337_1084537351 7 Left 1084537337 11:69764816-69764838 CCAGTTCTTCTAGCTCGATCCAG No data
Right 1084537351 11:69764846-69764868 CCTACATGGGGTCCTGGGGGAGG No data
1084537335_1084537351 9 Left 1084537335 11:69764814-69764836 CCCCAGTTCTTCTAGCTCGATCC No data
Right 1084537351 11:69764846-69764868 CCTACATGGGGTCCTGGGGGAGG No data
1084537336_1084537351 8 Left 1084537336 11:69764815-69764837 CCCAGTTCTTCTAGCTCGATCCA No data
Right 1084537351 11:69764846-69764868 CCTACATGGGGTCCTGGGGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1084537351 Original CRISPR CCTACATGGGGTCCTGGGGG AGG Intergenic